ID: 980029564

View in Genome Browser
Species Human (GRCh38)
Location 4:127811550-127811572
Sequence ATTGAGAAGCAAAATTTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980029562_980029564 11 Left 980029562 4:127811516-127811538 CCATGGAATCTTCAGTGTGGCTA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG 0: 1
1: 0
2: 2
3: 37
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980029564 Original CRISPR ATTGAGAAGCAAAATTTGGA AGG Exonic
900018046 1:168173-168195 ATTGAGAAGCAACTTTTGCTTGG - Intergenic
900048304 1:526769-526791 ATTGAGAAGCAACTTTTGCTTGG - Intergenic
900070529 1:768621-768643 ATTGAGAAGCAACTTTTGCTTGG - Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
905113358 1:35614826-35614848 ATTAAGAGGCAAAATTTTGGTGG - Intronic
907188046 1:52626296-52626318 ATTGAGCAGTAATATTTTGAAGG - Intergenic
907827393 1:58032049-58032071 TTTGAGAAGCAGAGTTTAGAAGG - Intronic
908605089 1:65790068-65790090 AGTGAGATGGAAAATTGGGATGG - Intergenic
908614938 1:65909721-65909743 ATTCAGAAGCAAATTTTATAAGG + Intronic
909430598 1:75583312-75583334 AATGAGATCCAATATTTGGAAGG - Intronic
909571771 1:77120516-77120538 ATTTAAAAGCAAATTTTGGCCGG - Intronic
909592014 1:77361078-77361100 AGTGAGCAGCAAAGCTTGGATGG - Intronic
909679835 1:78279262-78279284 ATTCAGAGGGAAACTTTGGATGG + Intergenic
909769964 1:79409499-79409521 ATTAAGAACCAAAATATGCAGGG - Intergenic
909856770 1:80544198-80544220 ATGGAAAAGCAAAATTTAAATGG + Intergenic
910272766 1:85414942-85414964 TTTTAAAATCAAAATTTGGAAGG + Intronic
910468482 1:87525461-87525483 AGTGAGAACCAACATTTAGAGGG + Intergenic
911390856 1:97240250-97240272 TTTGAGAAGCAAAATGTCCATGG + Intronic
911855017 1:102865614-102865636 ATAGCCAAGCAAACTTTGGAAGG - Intergenic
911905563 1:103564441-103564463 ATAGGGAAGGAAAATTTGCAGGG - Intronic
912061907 1:105684693-105684715 ATTAAGAATGAAAATATGGAAGG + Intergenic
913401623 1:118440783-118440805 ATAGGGATGGAAAATTTGGAAGG - Intergenic
917171765 1:172184510-172184532 AATGAGCAGCACAATCTGGAGGG + Intronic
917664242 1:177208350-177208372 GTTGAGAGGCAAATTTGGGAAGG + Intronic
917751163 1:178054863-178054885 ATTGAGCAGCAAAAAATGGATGG - Intergenic
918748796 1:188243588-188243610 ATTTAAAAACAAAATTTGGGCGG + Intergenic
918781429 1:188704645-188704667 ATTACTAAGCAAAATTTAGAAGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
924903300 1:248425489-248425511 ATCAAGAAGCCATATTTGGAAGG - Intergenic
924924560 1:248666315-248666337 ATCAAGAAGCCATATTTGGAAGG + Intergenic
1063938064 10:11099413-11099435 AATGAGAAATAAAATCTGGAGGG - Intronic
1064279066 10:13934528-13934550 AAAGAGAAGCAAACTTTGCAGGG + Intronic
1066625985 10:37406209-37406231 ATTGTGAAGCAAAATCTTGTAGG + Intergenic
1067787514 10:49261274-49261296 ATGGAGAAGGAAAATTGGCAGGG - Intergenic
1068183658 10:53556327-53556349 ATTGAGAAGCCTAATTGAGAAGG + Intergenic
1071123607 10:82309224-82309246 ATTCATAGGCAAAATTAGGAGGG - Intronic
1071192779 10:83121498-83121520 GTTCAGAAGCAAAAGTAGGATGG - Intergenic
1071463138 10:85917393-85917415 ATTTAGAGGGTAAATTTGGAGGG - Intronic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071634458 10:87237612-87237634 ATTTAGAACCAAAATTTGCTGGG - Intergenic
1071757538 10:88560603-88560625 ATTCAGAAGCAAACTCTGGGAGG + Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072535777 10:96361609-96361631 TTTGAAAAGGAAAATTTGGCCGG + Intergenic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073521565 10:104135906-104135928 ATTGAAAACAAAAAGTTGGATGG + Intronic
1073744340 10:106448344-106448366 TTTGCAAAGCAAAAATTGGAAGG + Intergenic
1076067509 10:127460424-127460446 CATGAAAAGCAAACTTTGGAAGG + Intergenic
1076278657 10:129226255-129226277 ATTGTGAAGCAAAATGTGTTAGG + Intergenic
1076974648 11:163369-163391 ATTGAGAAGCAACTTTTGCTTGG - Intergenic
1078235387 11:9479968-9479990 GTTGAAAAGGAAAATATGGAGGG - Intronic
1078947743 11:16089723-16089745 ATTGAGAAGCTACAGTTGGATGG - Intronic
1078965996 11:16343697-16343719 ATTGAAAATCAAAATTCAGAGGG + Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1080372261 11:31665024-31665046 ATACAGAGGCAAAATTTGGTTGG - Intronic
1080430416 11:32193376-32193398 ACTGAGAAGCAGATTTTGGGGGG + Intergenic
1081249986 11:40817589-40817611 GAGAAGAAGCAAAATTTGGATGG - Intronic
1082053506 11:47793283-47793305 CTAGAGAAACAAATTTTGGAAGG - Intronic
1082091228 11:48091212-48091234 ATTGAGATGCAAACATAGGAAGG - Intronic
1083114646 11:60448517-60448539 AATGCCAAGCAAAGTTTGGAAGG + Intronic
1083821525 11:65173923-65173945 ATTGGGAAACAAAACTTGAATGG + Intergenic
1084278505 11:68069937-68069959 ATTGAGAAGGAAAATGTCAAAGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085017181 11:73182380-73182402 AATGGGAACCAAAAATTGGAAGG - Intergenic
1085248736 11:75127044-75127066 ATTGAAAAGGAAAATTTGGCTGG + Intronic
1085879969 11:80454940-80454962 ATTTCTAAGCAAAATATGGAAGG - Intergenic
1087571617 11:99934590-99934612 ATTGAAAATCAAAATATGGGCGG + Intronic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1089187558 11:116630015-116630037 ATTTCTAAGCAAAATATGGAGGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090516301 11:127431530-127431552 ATTTAGAAGCAAAATTTATATGG + Intergenic
1090681714 11:129066249-129066271 ATTGGGAATCAAAAATTGTAAGG - Intronic
1090769343 11:129905956-129905978 ATTGAGAAGCCACATTTGAAGGG - Intronic
1090898946 11:131008205-131008227 ATTTAAAAGCCAACTTTGGAAGG - Intergenic
1093543007 12:20310167-20310189 ATTTAGAAATAAAATTTGGAGGG + Intergenic
1094012625 12:25825252-25825274 ATTTAGAATGAAAATTTAGATGG + Intergenic
1094235378 12:28159479-28159501 TTTAAGAAGCAAAAATTGAAAGG - Intronic
1095578553 12:43767696-43767718 ATTGAGAAACATAAATTGAAAGG + Intronic
1095980114 12:47967920-47967942 ATTGAGAAGCCTTGTTTGGAAGG + Intronic
1096039005 12:48497911-48497933 TTTGAGAAGTAAAAATTTGAAGG - Intergenic
1097322582 12:58242709-58242731 ATTGAGAATCAACATTTTCAAGG - Intergenic
1098588073 12:72178959-72178981 ATATAGAAGAACAATTTGGAAGG + Intronic
1099200626 12:79672507-79672529 GTTGAGATCCAAACTTTGGAAGG - Intronic
1099277447 12:80595183-80595205 GTTGAGAAACAAATTTTGGGAGG - Intronic
1100061750 12:90587226-90587248 ATTGAAAAGCAAAACTTGTCAGG - Intergenic
1100144428 12:91659929-91659951 AATGAGAAGAAATATATGGAAGG + Intergenic
1100544994 12:95593160-95593182 ATTGAGAAAGAAAATTTGTCAGG - Intergenic
1101956271 12:109215115-109215137 AGGGAGAAGCAAAATTTACATGG + Intronic
1103184579 12:118945381-118945403 ATAGCAAGGCAAAATTTGGAAGG + Intergenic
1105574629 13:21638737-21638759 ATGCAGAAGCATATTTTGGAGGG - Intergenic
1105627617 13:22128356-22128378 ATTGAGAAGAAATATTTGAAAGG + Intergenic
1105941446 13:25151553-25151575 AATGAAAAGCAAATATTGGAAGG - Intergenic
1106060857 13:26289844-26289866 ATTAAGAAGCAAATTTCGGCCGG - Intronic
1106124935 13:26893236-26893258 ATTGAGAGGCAAGATTCTGATGG + Intergenic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106790361 13:33149569-33149591 ATTCAGAAGGAAGATTTGGATGG - Intronic
1107320931 13:39187579-39187601 ATTTAGAAGCAAAATAGGGAAGG - Intergenic
1107322200 13:39201770-39201792 ATTGAGAAGCTATTTTTTGACGG - Intergenic
1107440525 13:40423354-40423376 GTTGATAAGTAAAATTAGGAAGG - Intergenic
1108736894 13:53293632-53293654 CTTGAGAAGAAAATTTTGGGAGG - Intergenic
1108882505 13:55137703-55137725 TTTGAGAATCAAGATTTGTAAGG - Intergenic
1109779320 13:67086572-67086594 CATCAGAAGTAAAATTTGGATGG + Intronic
1109787231 13:67194091-67194113 ATTGAGAAGAAAACTTTGTTTGG + Intronic
1110349030 13:74485371-74485393 CTTGAGAATGAAAATTTGAACGG - Intergenic
1110743341 13:79023282-79023304 ATTGGGAAGAAAAAATGGGATGG + Intergenic
1111002624 13:82205434-82205456 ATTGAAACCCAAAGTTTGGAGGG - Intergenic
1111067209 13:83109115-83109137 ATTGGAAAGCACAATTTAGATGG - Intergenic
1111682966 13:91466681-91466703 ATTGAGAAGGAAAATTTCAGAGG + Intronic
1115213004 14:30987012-30987034 ATTAAGAAACAAAATTTTGTTGG - Intronic
1115417793 14:33157086-33157108 ATTGAATAGCAAATTTTTGATGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1116201103 14:41797852-41797874 ATTGAGAAGCAATACATGTATGG - Intronic
1116699746 14:48224773-48224795 ACTGAAAAGTAAAATTTGTAGGG + Intergenic
1117020216 14:51562753-51562775 ATTAAGAAACACAATTTGCATGG + Intronic
1117180299 14:53184567-53184589 ATTTAAAAACAAAAATTGGAGGG + Intergenic
1119054177 14:71402241-71402263 ATTGAGAGGCAATATATTGATGG + Intronic
1121034131 14:90685185-90685207 AGTGTCAAGCAAAATTTAGATGG - Intronic
1121184758 14:91956841-91956863 CTTGAGAAGAAAAATGTGCAGGG + Intergenic
1121976005 14:98404714-98404736 TTTGAGAAGCCAACTTTGAAAGG + Intergenic
1202933000 14_KI270725v1_random:56571-56593 ATTAAGAAGCAGAACTTGGCCGG + Intergenic
1124021344 15:25927364-25927386 ATTCAAAAGTAAAATTAGGATGG - Intergenic
1124867692 15:33509378-33509400 AGTGAGATGCTAAATCTGGATGG - Intronic
1126096679 15:45095284-45095306 GTTGAGATGCCAAACTTGGAGGG - Intronic
1126240226 15:46433410-46433432 ATTTAGGAGGAAAAATTGGAAGG + Intergenic
1127341391 15:58048524-58048546 ATTGAGAAGGGAAGTATGGATGG + Intronic
1127720431 15:61693880-61693902 ATTTATAAGCAAAATATTGAAGG + Intergenic
1127739050 15:61880177-61880199 AGTTACAAGCAAATTTTGGAAGG + Intronic
1127891658 15:63257561-63257583 ATTGAAAAACAAAATGTGGCTGG - Intronic
1128821896 15:70664140-70664162 ATTTAGAAGCTAATGTTGGAAGG - Intronic
1129057366 15:72830329-72830351 ATTTCCAAGCAAAATATGGAAGG - Intergenic
1130416412 15:83698561-83698583 CTTAAGTAGCAAAAGTTGGAGGG - Intronic
1131866460 15:96716354-96716376 ATTGAGAAGCCAAGTTTTGAAGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1137331147 16:47497966-47497988 ATTGAAAAACAAAATTTGCAAGG - Intronic
1137687861 16:50399385-50399407 CTAAAGAAGCAAAATTTGGCTGG - Intergenic
1137988971 16:53132325-53132347 ATTGAGAAACTAAATTCTGACGG - Intronic
1138783880 16:59822422-59822444 ATTTATAAGCAAAATTTTGTGGG - Intergenic
1138897033 16:61219046-61219068 TTTCAGAGGGAAAATTTGGATGG + Intergenic
1139256243 16:65545623-65545645 ATTGAGGAGAAATGTTTGGAGGG - Intergenic
1139271426 16:65687059-65687081 ACTGGGAAGCAAGATCTGGAGGG + Intergenic
1139428283 16:66896505-66896527 AGCAAGAAGCAAAAGTTGGAGGG - Intergenic
1140023554 16:71262476-71262498 AGAGAGAAGCAAAAGTTGAAGGG + Intergenic
1140089452 16:71825699-71825721 ATAGGGAAACAAAATCTGGAAGG - Intergenic
1140641204 16:76975612-76975634 ATTTGGAATCAGAATTTGGAAGG - Intergenic
1141263445 16:82474512-82474534 CTGGAGAAACAAAATCTGGAAGG + Intergenic
1141335912 16:83155286-83155308 ATTGTAAAGCAAAAATTGCATGG + Intronic
1142445618 16:90134289-90134311 ATTGAGAAGCAACTTTTGCTTGG + Intergenic
1142461896 17:101182-101204 ATTGAGAAGCAACTTTTGCTTGG - Intergenic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1146372194 17:32272164-32272186 ATTGAGAATCAGAATTTGCTTGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1148244722 17:46023132-46023154 ATTGCAAAGGAAAATGTGGAAGG - Intronic
1148730020 17:49828538-49828560 AAAGAGAAGCAAACTTTGGCAGG - Exonic
1148963699 17:51416406-51416428 ATTGAGATGGAAAAATGGGATGG + Intergenic
1149645661 17:58239683-58239705 ATTGAGAACCAAAGTCTGGAAGG + Intronic
1150182242 17:63135452-63135474 ATTGAGAACCTAAAAGTGGAAGG - Intronic
1150262131 17:63802595-63802617 ATTAAAAAACAAAATTTAGATGG - Intronic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1152110973 17:78357715-78357737 AGGGGGAAGCAACATTTGGAGGG - Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153288075 18:3474951-3474973 TTTGAGAAACACAATTTGTAAGG + Intergenic
1153439714 18:5102718-5102740 ATTGAGTATTAAAATTTGGACGG + Intergenic
1154989039 18:21582589-21582611 ATTGAGAAGCCAAGTTTGAAGGG + Intronic
1155601206 18:27550303-27550325 ATAGAGAAGAAAAATTTAAAAGG + Intergenic
1156051020 18:32934272-32934294 ATTGAGAAACAAAAGATAGATGG - Intergenic
1156700428 18:39818381-39818403 GTTGAGAAGCAGATTTTGGAGGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159329734 18:66976345-66976367 ATTGGGAAATAAAATTTAGATGG - Intergenic
1159535928 18:69714714-69714736 ATTTAGAAGGAAATTTTGCAAGG + Intronic
1160109745 18:76015345-76015367 ATTTAGATGCAAAATGTAGAAGG - Intergenic
1160608431 18:80069491-80069513 ATTGCAAAGCAAAATGTAGATGG + Intronic
1160651600 19:233550-233572 ATTGAGAAGCAACTTTTGCTTGG - Intergenic
1161799240 19:6406630-6406652 ATTAAGAACCAAAATTTTTAGGG - Intergenic
1162119547 19:8454716-8454738 TTTGTGAAGCTAAAATTGGATGG + Intronic
1165116024 19:33529307-33529329 AATGAGAAGGAAAGCTTGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
925694800 2:6565158-6565180 TTGGAGAAGGAAAATTTGGCAGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926317645 2:11723096-11723118 ATGGAAAAGCCACATTTGGAAGG - Intronic
927399344 2:22693084-22693106 ATTGAGTAAAAAAATATGGAAGG - Intergenic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
932088881 2:68787291-68787313 ATTGAGAACCTACATTTGAAAGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932876909 2:75461939-75461961 GTTGAGAAGATAAATTTAGAAGG + Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933461907 2:82598998-82599020 TTTTAGATGCTAAATTTGGAGGG + Intergenic
933471038 2:82723897-82723919 ATTCAGAAGCATAATTTCCATGG - Intergenic
933735555 2:85491169-85491191 ATTGAGAAGGAAGATTGAGAAGG - Intergenic
935990365 2:108713662-108713684 AATGAGCAGCAGAATTTGAAAGG + Intergenic
937431315 2:121841012-121841034 ATGAAAAAGCAAAATTTGGTTGG - Intergenic
937496876 2:122429594-122429616 CTAGAGAAGCAAGGTTTGGAAGG - Intergenic
938014117 2:127853143-127853165 ATTTAGAAGCAAACTTTTGAAGG - Intronic
939056940 2:137377315-137377337 ATTTAAAAACAAAATTTTGAAGG + Intronic
939117422 2:138076382-138076404 TGTGAGAAGAGAAATTTGGATGG - Intergenic
939277471 2:140017626-140017648 ATAGAGAAACAAAATGTGGTAGG + Intergenic
940689449 2:156897013-156897035 CTTGATAAGCAGAATTTGTAAGG + Intergenic
941017226 2:160371296-160371318 TTTGAGAGGCAAAATGTAGAAGG - Intronic
941950661 2:171152456-171152478 ATTGAGAGGCAGGATTTGAATGG - Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
943172897 2:184426726-184426748 ATTTAGAAGTAAAATTAGAAAGG - Intergenic
946220729 2:218223908-218223930 ATTGAGAAGCAATCTTGTGATGG + Intronic
946354373 2:219175978-219176000 ATTGAAAAGCTAATTTTCGAAGG - Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
948277937 2:236724343-236724365 GTTGAGAACCACACTTTGGATGG + Intergenic
948464617 2:238146216-238146238 ATCGAGAAACAAAATGTGGCCGG + Intronic
1169314632 20:4579687-4579709 ATTGAGAAACAAAATCATGAAGG - Intergenic
1170855365 20:20048502-20048524 CTTAAGAAGCAAGATTTGCAGGG + Intronic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171502133 20:25602042-25602064 GGTGAGAAGTGAAATTTGGATGG - Intergenic
1172711333 20:36926686-36926708 TTTGAGAAGTAAAATTAGGTTGG - Intronic
1174701753 20:52616517-52616539 CTTGGGAAGCATAATTTGGGGGG + Intergenic
1175602755 20:60288288-60288310 AATAAGAAGCTAAAATTGGATGG - Intergenic
1177150736 21:17453277-17453299 ATTGGGAAGTAATATTTGGGTGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177474286 21:21598464-21598486 ACATAGAATCAAAATTTGGATGG - Intergenic
1177830875 21:26137358-26137380 ATAAAAAAGCAAAATTTAGATGG - Intronic
1180339067 22:11603707-11603729 ATTGAAAAGCAAAAGTAGCAGGG + Intergenic
1181433371 22:22896065-22896087 ATTGAGAAGTAAAATTTAGGAGG - Intronic
1181435325 22:22907038-22907060 ATTGAGAAGTAAAATTGAGGAGG - Intergenic
1181872481 22:25911003-25911025 CATGAGAAGCAAGATTTGGAAGG + Exonic
1182192505 22:28477399-28477421 AGTGATAAGTGAAATTTGGAGGG - Intronic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
949180578 3:1125346-1125368 ATACATAAGCAAAATTTGGAAGG + Intronic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
949631301 3:5929595-5929617 TTTGAGAGTCAAAATTTGGCAGG - Intergenic
951366704 3:21792076-21792098 TTTGAGAATCAAAAGATGGAGGG + Intronic
951932163 3:27980587-27980609 ATTGAGCAGCTAAATTGGTAAGG - Intergenic
952061776 3:29519441-29519463 ATTGAGAAACAAAATATAAAAGG + Intronic
952172576 3:30825043-30825065 ATTGAAAATCATAATTTAGAGGG - Intronic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952769095 3:36981251-36981273 ATTGGGAAGCCAAAGTGGGAGGG - Intergenic
953164375 3:40451809-40451831 GTTGAGAAGAAAAATCTGCATGG + Intergenic
953197189 3:40745691-40745713 ATGGAGAAGCAAGACTGGGAAGG - Intergenic
954063276 3:48087095-48087117 ATTTTGAAGCTAAATTTGAAAGG + Intronic
955139122 3:56251570-56251592 GTTGCTAAGCAACATTTGGATGG + Intronic
955225306 3:57055559-57055581 ATTGAGAACCTAAATGTGCAAGG - Intronic
955252223 3:57295213-57295235 ATTCAGAATCAAAATATGGATGG + Intronic
955596680 3:60598169-60598191 ATTCAGAAACAAGATTTGGGGGG + Intronic
955627913 3:60938832-60938854 ATTGAGAAACATAATTTGAATGG + Intronic
955739751 3:62077530-62077552 ATTAAGAAGCAAAATTTTAATGG - Intronic
956197097 3:66663839-66663861 AATGAGCAGCAGCATTTGGAAGG - Intergenic
956375003 3:68604582-68604604 ATTGAGACAGAAAATTTGCAAGG + Intergenic
956495943 3:69825868-69825890 ATTAAAAAGTAAAGTTTGGAGGG - Intronic
957240005 3:77647429-77647451 ATTGAAAAGAAAAATTTAAAAGG + Exonic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
957902397 3:86511971-86511993 ATTGAGAAGTAAAGTTTTGGTGG + Intergenic
958056658 3:88421156-88421178 ATAGAGAAATAAAGTTTGGAAGG - Intergenic
958821743 3:98982433-98982455 AATGACAAGAAAAGTTTGGAAGG - Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959398750 3:105873122-105873144 ATTTAGCTGCAAAATCTGGAAGG + Intergenic
960899329 3:122538980-122539002 ATTCAGAGGCAAAATTTCAAAGG - Intronic
963366129 3:144336791-144336813 ATTTAGAGACAAATTTTGGAGGG + Intergenic
963806210 3:149725665-149725687 TTTCAGAAGGAAAATTTTGAAGG + Intronic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
965988139 3:174781464-174781486 ATTGAAATTCAAAATTTTGAGGG - Intronic
966196666 3:177320656-177320678 AATGAGGAGCACAATTTGGAGGG + Intergenic
967013311 3:185459317-185459339 GTAGAGAAGCAAGATTTGGGGGG - Intronic
967138685 3:186534249-186534271 GTTGAGAAGCAGAAGTTGCACGG + Intergenic
967525953 3:190492953-190492975 ATTTAGAAGTAAAGTTTGCAAGG - Intergenic
968366232 3:198186419-198186441 ATTGAGAAGCAACTTTTGCTTGG + Intergenic
970147705 4:13054182-13054204 ATAGAGAAACAAAATCTGGAGGG - Intergenic
970458815 4:16252473-16252495 ATACACAAGAAAAATTTGGAGGG - Intergenic
970630822 4:17942443-17942465 ATTAAAAAGCAACATTTGGGAGG - Intronic
970810758 4:20091191-20091213 ATTGAGACTGAGAATTTGGAGGG + Intergenic
970817038 4:20168806-20168828 AATGAGAAGCAAAATGTAGGGGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
972163638 4:36256276-36256298 GTTCAGAAGCACAGTTTGGAAGG - Intergenic
972586879 4:40445748-40445770 ATTTAAAAGCAAAATTCTGATGG - Intronic
973017731 4:45162755-45162777 ATAAAGAAGGAAACTTTGGAAGG - Intergenic
973589172 4:52423171-52423193 ATTGAGACGTAAAATGTGGCAGG - Intergenic
974400190 4:61393220-61393242 ATTGAGAAGAAAAAGTTAGTTGG + Intronic
974766303 4:66350971-66350993 ATAAAGAATGAAAATTTGGATGG + Intergenic
976018118 4:80585141-80585163 ATTTAGAAGGCAAATTTGGCAGG + Intronic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
978068331 4:104434189-104434211 ATTTAGAATAAAAATTTTGATGG - Intergenic
978629693 4:110729987-110730009 ATTGTGAATTAAAATTTAGAAGG - Intergenic
978926698 4:114253997-114254019 ATTGTGAAGCTAAATTTGGCAGG - Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980528663 4:134021771-134021793 ATTGAGAAGCAACATCTAAATGG - Intergenic
981006185 4:139878087-139878109 ATAGCGAGGCAAAATTTGAATGG - Intronic
981164997 4:141547392-141547414 ACTCAAAAGCAAAATTTGGTTGG - Intergenic
981573546 4:146178560-146178582 TTTGAAAAGCAAAAATTGCAAGG - Intronic
982309333 4:153968194-153968216 ATTGTGAAAGGAAATTTGGAAGG - Intergenic
982355068 4:154457557-154457579 CTTGTGAAGAAAAATTTGCATGG - Intronic
982781087 4:159492190-159492212 ATTTAGATATAAAATTTGGATGG + Intergenic
983990737 4:174116492-174116514 ATTGAGAAGGAAAAATTACAAGG - Intergenic
984019988 4:174474104-174474126 TTTTGAAAGCAAAATTTGGAAGG - Intergenic
984213859 4:176883527-176883549 GTTAGGAAGCAAAATTTGGCTGG - Intergenic
984671968 4:182500053-182500075 ACTTAGAAGCAATATTTTGATGG - Intronic
986418488 5:7552343-7552365 AGTGAGAAGCAGTATTTTGATGG + Intronic
986809527 5:11341062-11341084 TGTGTGAAGCATAATTTGGAGGG + Intronic
987837838 5:23184642-23184664 CTTTAGAAGCAAGAATTGGAAGG - Intergenic
988584093 5:32493888-32493910 ATAGTGAAGCAAAACTTGGAAGG + Intergenic
989522980 5:42423216-42423238 ATGGAAAGGCAATATTTGGATGG + Intergenic
989785665 5:45325501-45325523 ATTGATATGATAAATTTGGAGGG + Intronic
990251383 5:53918998-53919020 ATTGGGAAGGAAAATTTCAATGG + Intronic
990979138 5:61586082-61586104 ATCGCTAAGCAACATTTGGAAGG + Intergenic
991132942 5:63146297-63146319 ACTGATAAGCAAAATTTGCAAGG + Intergenic
992027443 5:72684609-72684631 AGTGAGAAACAAAAGATGGAAGG - Intergenic
992589245 5:78276433-78276455 ATTTAGAAGCAAATTTAGGCTGG + Intronic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
994139247 5:96323567-96323589 ATTAAAAAGAAAAATATGGAAGG - Intergenic
994504720 5:100628287-100628309 ATGAAGAAGCACACTTTGGATGG - Intergenic
996413909 5:123188810-123188832 ATAGAGAAGCAAAATTAAAAGGG - Exonic
996444861 5:123535805-123535827 ATTGAACATCAAAATTTGAACGG - Intronic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
998640282 5:144002593-144002615 ATTGAGAGGAGAGATTTGGAGGG - Intergenic
998941796 5:147291359-147291381 CATCAGAAGCAAAATTGGGATGG + Intronic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
1000507640 5:162141331-162141353 ATTAAAAAGCAAAATTTGGCTGG - Intronic
1000891417 5:166806918-166806940 ATTGAGAAGTGAAAATGGGAAGG + Intergenic
1000904880 5:166953027-166953049 GCTGAGAAGCAAAATGTGTAAGG - Intergenic
1003195085 6:3907197-3907219 ATTGAGAATCCAAATCTGCAGGG - Intergenic
1004829955 6:19465911-19465933 ATTTGGAAGAATAATTTGGAGGG + Intergenic
1005098081 6:22140600-22140622 GTAGAGAAGGAAAATCTGGATGG + Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008654929 6:53602169-53602191 ATTGAGAAACAGCATTTGGGAGG + Intronic
1008705844 6:54157916-54157938 ATTAAATAACAAAATTTGGAAGG - Intronic
1009370081 6:62888728-62888750 TTTAAAAAGCAAGATTTGGAAGG - Intergenic
1009450276 6:63791960-63791982 ATTTGGAAGGAAAATTTGAAAGG + Intronic
1009768908 6:68119885-68119907 ATTGAAAAACTAAATTGGGAGGG - Intergenic
1010269106 6:73901147-73901169 ATTGAGAAGCAAAGCTAGGCTGG - Intergenic
1011526826 6:88274903-88274925 AAAAAGAAGCAAAATTTTGATGG + Intergenic
1014421736 6:121254230-121254252 GTACAGAAGGAAAATTTGGAAGG + Intronic
1015409773 6:132880306-132880328 ACTGGAAAGCAAAAGTTGGAAGG - Intergenic
1015449817 6:133353388-133353410 ACCTAGAAGCAAAATTTGGAAGG - Intronic
1015887543 6:137933775-137933797 ATTGAGAAGCCAAAATAGGAAGG - Intergenic
1017702816 6:157092204-157092226 ATTGCTAAGCAGCATTTGGAAGG - Intronic
1018147517 6:160906424-160906446 CTTGAGGAGCAAAAGTAGGAAGG + Intergenic
1018256673 6:161926923-161926945 AAGGAGAAGCAAAATTTAGAGGG - Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020444710 7:8256941-8256963 AGTGAGAAACAAAGTTTAGAAGG + Intronic
1020524944 7:9247473-9247495 ATGGAGTAGCAAATTTTGGGAGG - Intergenic
1020581398 7:10007269-10007291 ATTGTGAAAGAAAACTTGGAAGG + Intergenic
1021856821 7:24865211-24865233 CTTTACAAGCAAAATATGGAAGG + Intronic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1022307995 7:29168037-29168059 AGTGAGAAGTAAAATTTTGTTGG + Intronic
1024773996 7:52760984-52761006 TTAGAGAAGCAGAATTTGAAAGG + Intergenic
1024960951 7:54975553-54975575 ATTGAGAAACAAAACATGAAAGG + Intergenic
1025580579 7:62710363-62710385 TTTGTGAAGGAATATTTGGAAGG - Intergenic
1028011736 7:85653629-85653651 AAGGAGAAGAAAAATTTGGTAGG - Intergenic
1028089200 7:86676693-86676715 AAAGAGTAGCAAAATTTGGGAGG + Intronic
1028309037 7:89306550-89306572 CTTGAGAAGTAAAATTTTGGGGG + Intronic
1028704597 7:93824958-93824980 ATTTAAAAGCAAAATATTGAAGG - Intronic
1028829535 7:95312396-95312418 GTTAAGATGCAAAATTTGGCAGG + Intronic
1029009378 7:97242586-97242608 ATTAAGAAGCAAAATGTGCTGGG + Intergenic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031005641 7:116467922-116467944 AGTGAGGAGCAAAATTAGCAAGG - Intronic
1034394320 7:150808977-150808999 AGTGAGAAGAAAAGTTTAGAGGG + Intergenic
1034905863 7:154945275-154945297 TTTAAGAAGTAAAATTTGGCCGG - Exonic
1038171466 8:25137614-25137636 GTAGAGAAGGAAAATTTTGAAGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1039021368 8:33210439-33210461 AATGAGAAGCATAATTTTAATGG - Intergenic
1039871512 8:41549678-41549700 ATACAGAAGTAAAAGTTGGATGG - Intergenic
1040293470 8:46137249-46137271 TTGGAGAGGCCAAATTTGGAGGG + Intergenic
1040477311 8:47791178-47791200 ATTAATAAGCAAAATATGGCCGG + Intronic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1041605061 8:59772319-59772341 AATGAGCAGGAACATTTGGAAGG + Intergenic
1041871691 8:62641679-62641701 AGTGAGAGGCAAGATTAGGAAGG + Intronic
1041947759 8:63465581-63465603 ATTCAGAAGCATAATTTCCACGG - Intergenic
1042890373 8:73603374-73603396 AATTAGAAACAAAATTTAGAAGG - Intronic
1043851037 8:85216911-85216933 ATTGAAATGCACAATTTGAAAGG - Intronic
1044111388 8:88279703-88279725 ATGGAAAAACAAAATATGGAGGG + Intronic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1047031344 8:120884907-120884929 ATTCAGAAGCCAAATTGGAAAGG + Intergenic
1047135917 8:122078482-122078504 AATTATAAGCAAAATTTGAAAGG + Intergenic
1047462643 8:125082404-125082426 ATTGAGAAGCACAGTTTCTAAGG + Exonic
1048059273 8:130900697-130900719 CTTGAGGAGCACAAGTTGGAAGG - Intronic
1048085112 8:131169011-131169033 ATGTAGAAACAAAATTTGAAGGG - Intergenic
1048341623 8:133544210-133544232 ATTGAGATGCACAGTTTGTATGG - Intronic
1048819145 8:138363824-138363846 AATGAGCTGCAACATTTGGATGG + Intronic
1049137833 8:140921036-140921058 AGCTTGAAGCAAAATTTGGAAGG + Intronic
1050022108 9:1294915-1294937 ACTGAGAAGGAAAATTTTGGAGG - Intergenic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1051316824 9:15844964-15844986 ATTGAGCAGAAGAATTTGAATGG + Intronic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1052349649 9:27445588-27445610 TTTGAGATGCCAAATATGGATGG + Intronic
1053111594 9:35465224-35465246 ATTGAGAAGGAAAGATTGCATGG + Intergenic
1054676906 9:67864817-67864839 ATTGAAAAGGAGAATTTTGAAGG - Intronic
1055869605 9:80858704-80858726 ATTGAGAAACAAAATTTTCGAGG + Intergenic
1056420402 9:86420700-86420722 TTTGAGAATCAAAATTTTAAAGG - Intergenic
1058093366 9:100830310-100830332 ATTGAGTAGCAAATTTTTGATGG + Intergenic
1058882658 9:109298971-109298993 CTAGAGAAGCAAAAATAGGAGGG + Intronic
1058946982 9:109866512-109866534 ATAGAGAAGAAAAATATGAAGGG + Intronic
1059919281 9:119139655-119139677 ATTGAAAAAAAATATTTGGAAGG - Intergenic
1060451216 9:123742484-123742506 ATTGAGCAGAAACATGTGGAAGG - Intronic
1060591455 9:124819624-124819646 AGCGAGGACCAAAATTTGGAGGG + Intergenic
1062750600 9:138249285-138249307 ATTGAGAAGCAACTTTTGCTTGG + Intergenic
1186413140 X:9361126-9361148 AATGAGAAGCGAAATTTGGTGGG - Intergenic
1186952708 X:14645016-14645038 AATGTGAAGAAGAATTTGGATGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188456080 X:30367693-30367715 AATGAGAAGTAATATTTGAAAGG + Intergenic
1188817290 X:34731073-34731095 ATTGAGAAAGAAAATTGGGTTGG - Intergenic
1188832479 X:34916815-34916837 TTATAGAAACAAAATTTGGATGG - Intergenic
1190989440 X:55530557-55530579 ATTGAGACGCAAAGTTTGGTAGG + Intergenic
1193672028 X:84398656-84398678 ATTGAGAGACAAAATTAGCAGGG + Intronic
1193735866 X:85155494-85155516 ATTGAGAAGCAAAAGTAAAACGG + Intergenic
1193987192 X:88257855-88257877 AGTGAGAATGAAAATTTGTAAGG - Intergenic
1194989294 X:100528206-100528228 ATTTAGAATCAAAATGGGGAAGG - Intergenic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1195569881 X:106385976-106385998 GTTCAGACTCAAAATTTGGAAGG - Intergenic
1196363118 X:114890017-114890039 ATAGAGAGGCAAATTTTTGAAGG + Intronic
1196840342 X:119853412-119853434 CTAGTGAGGCAAAATTTGGACGG - Intergenic
1199881963 X:151981027-151981049 CTTGAGAAGAAAAATTTCTATGG + Intergenic
1201981613 Y:19915598-19915620 ACTTAGAAGGACAATTTGGAAGG - Intergenic