ID: 980029940

View in Genome Browser
Species Human (GRCh38)
Location 4:127815730-127815752
Sequence GACTGTAAGTTATAGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980029940_980029946 -6 Left 980029940 4:127815730-127815752 CCACCCATCTATAACTTACAGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 980029946 4:127815747-127815769 ACAGTCTAGTGGGAGAGGACAGG 0: 1
1: 0
2: 2
3: 31
4: 229
980029940_980029947 28 Left 980029940 4:127815730-127815752 CCACCCATCTATAACTTACAGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 980029947 4:127815781-127815803 AAGATAGCATATAAATATAAAGG 0: 1
1: 1
2: 2
3: 49
4: 732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980029940 Original CRISPR GACTGTAAGTTATAGATGGG TGG (reversed) Intronic
900675502 1:3882927-3882949 GACTGTAAGTGATGGAAAGGTGG + Intronic
902680103 1:18037271-18037293 GGCTGTAAATTCTAGAAGGGTGG + Intergenic
906253450 1:44329466-44329488 GATTGGTAGTTACAGATGGGTGG - Intronic
906881322 1:49594515-49594537 GACTGTCAGTGGTGGATGGGAGG - Intronic
917455148 1:175179744-175179766 TACTGTAATTTGTAGAGGGGAGG + Intronic
918647218 1:186918598-186918620 GACTGGGAGTTATACATGGACGG - Intronic
920668886 1:207987811-207987833 GAATGTAAGTTATGTATCGGAGG - Intergenic
920722251 1:208398669-208398691 GACTGTCAGTAATGGATAGGGGG + Intergenic
922344542 1:224685289-224685311 CACTGTAAGTGCTGGATGGGTGG + Intronic
1064697441 10:17982499-17982521 CACTGTGAGTTAGAGGTGGGTGG - Intronic
1066981721 10:42422767-42422789 GACAGTAAGCTATAGTTGGGAGG - Intergenic
1070310693 10:75271563-75271585 GAATTTAAATTCTAGATGGGGGG - Intergenic
1070685108 10:78474839-78474861 CACTTTACGTTATATATGGGAGG + Intergenic
1071282197 10:84112954-84112976 GACTGGGAGTTATACATGGATGG + Intergenic
1079478471 11:20856884-20856906 GATTGCATCTTATAGATGGGAGG + Intronic
1081237944 11:40668699-40668721 AACTGTAATTTATAGCTGAGAGG - Intronic
1084915712 11:72427412-72427434 GACTGTAGGTTACACATGGTTGG - Intronic
1087308305 11:96509242-96509264 GAGTGTAAGTTCTATAAGGGTGG + Intergenic
1093674276 12:21917322-21917344 GACCGTACATGATAGATGGGAGG + Intronic
1094662898 12:32488343-32488365 GACTGTAAGTTTTAAATAGAAGG - Intronic
1095722677 12:45417696-45417718 GACTGTCAGTGAAATATGGGAGG - Intronic
1097101859 12:56595474-56595496 GAGTGTAAGTTTTAGAATGGTGG - Exonic
1097505915 12:60469642-60469664 GAGTGTAAATTATAGATTGGTGG - Intergenic
1098875177 12:75859676-75859698 GAGTGAAAGTTAGAGATGAGTGG + Intergenic
1100772460 12:97938520-97938542 GGCTGTGATTTAAAGATGGGTGG - Intergenic
1103672107 12:122625941-122625963 CCCTGTAAGTTATTAATGGGCGG - Intronic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1109804880 13:67425892-67425914 GACTGTATGATATAGTTTGGCGG - Intergenic
1111842821 13:93472367-93472389 GACTGTAAGTCATGGAGGTGTGG + Intronic
1114349037 14:21829652-21829674 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114353280 14:21878339-21878361 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114359102 14:21950232-21950254 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114377451 14:22163397-22163419 GACTGTGAGTTGTGCATGGGAGG + Intergenic
1115716926 14:36116054-36116076 GACTGTAAGTTCCACATGGAAGG + Intergenic
1120471416 14:84929916-84929938 GACTGCAAGTTGTAGGTGCGAGG - Intergenic
1121381130 14:93468328-93468350 TACTGTAAGGTAGAGATAGGAGG + Intronic
1127977455 15:64008414-64008436 GACTTTAAGTTCTAGATCTGTGG - Intronic
1130116116 15:81005816-81005838 AACTTTATGTTATAAATGGGAGG - Intergenic
1131832414 15:96362008-96362030 GAATGTAATTTATAGCTAGGCGG + Intergenic
1146023089 17:29295270-29295292 CAATGTATGTTATAGATTGGGGG + Intergenic
1146799178 17:35805085-35805107 GACTATAAGCTGTAGGTGGGGGG + Intronic
1156137525 18:34060492-34060514 TACTGTATGTTATTAATGGGTGG + Intronic
1162951676 19:14074869-14074891 GACTGTAAGTTTTATAGAGGGGG - Exonic
1165984457 19:39755823-39755845 GGCTGTAAGTGAAAGATGGGAGG - Intergenic
926377472 2:12248077-12248099 ATCTGTAAGTTAAAGATGGTTGG - Intergenic
932456796 2:71854608-71854630 GATTCTAAGTTATGGGTGGGAGG - Intergenic
948494091 2:238334662-238334684 GTGTGTAAGTTAAAGAAGGGTGG + Intronic
1170215559 20:13887378-13887400 GAATGTAAGGTATACATTGGAGG - Intronic
1173610009 20:44360259-44360281 GAATGGATGTGATAGATGGGTGG + Intronic
1178447688 21:32660541-32660563 GACTGGGAGTTATACATGGACGG + Intronic
1178833724 21:36078374-36078396 GACTGAAAGTTATAGAATTGTGG - Intronic
960995673 3:123338679-123338701 GACTGTGAGTGATGGATGGCAGG - Intronic
966806677 3:183813296-183813318 GACTCCAAGTTATTGATGGAAGG + Intergenic
967224283 3:187275973-187275995 GACTGAGAGGTACAGATGGGGGG - Intronic
979761738 4:124414463-124414485 CACTGTCAGTGATAGATGAGTGG - Intergenic
980029940 4:127815730-127815752 GACTGTAAGTTATAGATGGGTGG - Intronic
980780120 4:137482811-137482833 GACTGAGAGTTATACATGGATGG + Intergenic
981239720 4:142462518-142462540 GACTGCATGTTATAGATGACTGG - Intronic
982074838 4:151728285-151728307 GACAGGAAGTTACAGATGTGTGG - Intronic
983046503 4:162993231-162993253 GACTGTCAGTCATAGAGGGAGGG + Intergenic
985293371 4:188408734-188408756 TACTGGGAGTCATAGATGGGAGG - Intergenic
993013177 5:82507118-82507140 GAATGGAAGTTATAGAGGTGTGG + Intergenic
994423407 5:99552176-99552198 GACTGTCAGTTAAAGATGAATGG - Intergenic
995751811 5:115460144-115460166 GGCTGTAAGTTACAGATGCTGGG - Intergenic
999471734 5:151860639-151860661 CACAGTAAGTTATAGAAGGCTGG - Intronic
1001509958 5:172313414-172313436 GACTAAGAGTCATAGATGGGAGG - Intergenic
1005316100 6:24604229-24604251 GAAAGTATGTTAGAGATGGGAGG + Intronic
1014720313 6:124909560-124909582 GTCAGTAAGTCATAAATGGGAGG + Intergenic
1021213639 7:17887916-17887938 GACTGTAAGTTAAAGAATAGAGG + Intronic
1032867106 7:135936971-135936993 GATTGTAAATTATTTATGGGTGG - Intronic
1033240619 7:139676381-139676403 GACTGTCAGTGATGGATGTGAGG - Intronic
1036986121 8:13532833-13532855 TACAGTAGGTTAGAGATGGGGGG - Intergenic
1040886884 8:52273515-52273537 GACTGTAACTCTTAGATGTGGGG - Intronic
1044362860 8:91309009-91309031 GACTTTAAGATTTAGATGGTAGG + Intronic
1048008833 8:130440662-130440684 GAGTGTAAGGGAGAGATGGGGGG - Intronic
1048379469 8:133852296-133852318 GGCTGTAAATTATTGATAGGAGG + Intergenic
1049191321 8:141289372-141289394 GACTGTCTGTCATAGATGGAAGG - Intronic
1053249805 9:36564971-36564993 TACTTTAATTTAGAGATGGGGGG + Intergenic
1055368390 9:75570804-75570826 AACTGTAACTTATAGAAGGAAGG + Intergenic
1058095218 9:100852456-100852478 GAGTGAAAGTCATAAATGGGAGG - Intergenic
1058179699 9:101781679-101781701 GAGAGTAAGGTATAGATTGGTGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1060864769 9:126987031-126987053 CACTGTGGGTTATAGATGGGAGG + Intronic
1188021835 X:25167283-25167305 GACTGTAAGCTTCAGAAGGGTGG + Intergenic
1188178374 X:27022832-27022854 AACTGTAAGATATAGATTGTTGG - Intergenic
1190425869 X:50334189-50334211 GACTGGGAGTTATACATGGACGG - Intronic
1196000950 X:110785213-110785235 GTCTGTAAGTGAAAGCTGGGCGG - Intronic
1198970043 X:142269699-142269721 GACTGGGAGTTATACATGGACGG + Intergenic
1200394101 X:155973156-155973178 GACTGGGAGTTATACATGGACGG - Intergenic
1200414656 Y:2896271-2896293 GACTGCATGTTGTAGATGGTGGG + Intronic
1200943358 Y:8807489-8807511 GACTGGGAGTTATACATGGAGGG + Intergenic
1201270332 Y:12247758-12247780 GACTGGGAGTTATACATGGACGG + Intergenic