ID: 980032975

View in Genome Browser
Species Human (GRCh38)
Location 4:127851792-127851814
Sequence ACTAATATTCAGAATGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980032973_980032975 -10 Left 980032973 4:127851779-127851801 CCTCCAGCAAAGGACTAATATTC No data
Right 980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG No data
980032971_980032975 22 Left 980032971 4:127851747-127851769 CCTACAAAATGGGAGAAAACATT 0: 16
1: 430
2: 9171
3: 18207
4: 12540
Right 980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980032975 Original CRISPR ACTAATATTCAGAATGTGTA AGG Intergenic
No off target data available for this crispr