ID: 980037236

View in Genome Browser
Species Human (GRCh38)
Location 4:127899433-127899455
Sequence CCACAAAAACACATGGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980037236_980037240 23 Left 980037236 4:127899433-127899455 CCTAGGTCCATGTGTTTTTGTGG No data
Right 980037240 4:127899479-127899501 AGAGTCTCACTCTGTCGCCCAGG 0: 4925
1: 39417
2: 119577
3: 170658
4: 174535
980037236_980037241 27 Left 980037236 4:127899433-127899455 CCTAGGTCCATGTGTTTTTGTGG No data
Right 980037241 4:127899483-127899505 TCTCACTCTGTCGCCCAGGCTGG 0: 15310
1: 100461
2: 170004
3: 197206
4: 179472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980037236 Original CRISPR CCACAAAAACACATGGACCT AGG (reversed) Intergenic
No off target data available for this crispr