ID: 980039855

View in Genome Browser
Species Human (GRCh38)
Location 4:127926714-127926736
Sequence TGTATCAGGTTCAGTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980039855 Original CRISPR TGTATCAGGTTCAGTGCTAT GGG (reversed) Intronic
906646177 1:47476888-47476910 TCTATCAGGTACAATGCTAAGGG + Intergenic
907464430 1:54625318-54625340 TGGAGCAGGGTCAGTGCTCTGGG + Intronic
907554137 1:55330098-55330120 TGTATAAGCTGCAGTGCTATTGG + Intergenic
907826851 1:58026133-58026155 TGTGTCAGATTCAGAGCTCTAGG - Intronic
911494592 1:98615694-98615716 TGTGTCAGGTGCAGGGCTAGGGG - Intergenic
911806132 1:102210934-102210956 TGCATCAGCTGCAGTCCTATAGG + Intergenic
917148401 1:171917914-171917936 TGTATCATTTTCTGTGCAATAGG - Intronic
918417495 1:184326728-184326750 GGTATCAGGTCCAGTACTAGGGG - Intergenic
920976185 1:210787500-210787522 CGCATCAGGTACAGTGCTAGAGG - Intronic
924043262 1:240004465-240004487 TGTGTAAGATTCAGTGCTTTGGG + Intergenic
924926708 1:248691253-248691275 TGTCCCAGGTACAGTGCTAAAGG + Intergenic
1065481248 10:26195908-26195930 TGTGTCAGGTTGAATGCAATAGG - Intronic
1066585671 10:36932079-36932101 TATATCATGTTAAGTGTTATAGG + Intergenic
1068708696 10:60107397-60107419 TGTATGATGTTCAATGATATTGG + Intronic
1072506891 10:96076819-96076841 TGTATCAGTTACAATGCTTTTGG - Intergenic
1072769530 10:98126086-98126108 TGCATCAGCTGCAGTCCTATAGG + Intergenic
1075343357 10:121664558-121664580 TCTATGAGGTGCAATGCTATGGG - Intergenic
1075565414 10:123500012-123500034 TATATCAGGCTCAGAGCCATGGG - Intergenic
1075682060 10:124340300-124340322 AGTATCAGGGTCAGTGCTCCAGG - Intergenic
1079335810 11:19569623-19569645 TGTACCAAGCTCTGTGCTATGGG - Intronic
1084938443 11:72599748-72599770 TGGGTCAGGTTCAGTGCTGAGGG + Intronic
1086358596 11:86033168-86033190 TGTAATATGTTCAGTGCCATAGG - Intronic
1087040836 11:93798321-93798343 TGTATCTTTTTCAGTGCTAAAGG + Intronic
1087671377 11:101111311-101111333 TATTTCAGGTTCACTGCTTTAGG + Intronic
1087783567 11:102328522-102328544 TGTATCAGTTTCATTGCTCATGG - Intronic
1087804362 11:102539491-102539513 TGCATCAGCTGCAGTCCTATAGG - Intergenic
1088082050 11:105930063-105930085 TGTATCAAGTACAGTGATAAAGG - Intronic
1088824603 11:113483232-113483254 TGTGTCAGGTTCTGTGCTGGGGG - Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1089836997 11:121379352-121379374 TGCATCAGCTGCAGTCCTATAGG - Intergenic
1093291050 12:17322504-17322526 TGTATCAGCTGCAGTACTGTAGG + Intergenic
1099115940 12:78624110-78624132 TGTATTATGGTCAGTGCTTTTGG + Intergenic
1108483614 13:50901755-50901777 AGTAACAGGATCAGTGCAATGGG + Intergenic
1109258935 13:60119866-60119888 ACTATCAGGTACTGTGCTATAGG - Intronic
1110375938 13:74794113-74794135 TGCATCAGCTGCAGTCCTATAGG + Intergenic
1111603963 13:90513137-90513159 TTTACCAGGCACAGTGCTATGGG + Intergenic
1112624967 13:101093654-101093676 TGGACTAGGTTGAGTGCTATAGG + Intronic
1112914983 13:104537149-104537171 TGTATTATGTTCAGTTCTAGAGG - Intergenic
1115070210 14:29313155-29313177 TTTCTCATTTTCAGTGCTATTGG - Intergenic
1115829562 14:37320679-37320701 TAGAACATGTTCAGTGCTATGGG - Intronic
1116063942 14:39958602-39958624 TGCATCAGCTTCAGTACTATAGG - Intergenic
1116595743 14:46842159-46842181 TTTATCAGCTTCATTGCTAAGGG + Intronic
1116607501 14:47019965-47019987 TGTATTAGGTTCAGCGTAATTGG + Intronic
1120555154 14:85920562-85920584 TGTATTAGTTTCAGAGCTTTTGG + Intergenic
1126225516 15:46264131-46264153 TGTATCAGGTTCTGAACTCTAGG - Intergenic
1126978334 15:54211704-54211726 AGTGTCAGGTGCAGTGCTAGTGG + Intronic
1130906526 15:88244490-88244512 GCTATCAGTCTCAGTGCTATGGG + Intronic
1131625171 15:94109926-94109948 TATGTCAGGTTCAGTGCAAGGGG - Intergenic
1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG + Intronic
1133626266 16:7573313-7573335 TCTATAAGGTTCAGTGTTCTCGG - Intronic
1143267774 17:5653301-5653323 TGTCTCAGGTTCTGTTCTCTAGG - Intergenic
1145964648 17:28908050-28908072 TGTACCAGATACAGAGCTATCGG + Intronic
1154017306 18:10630436-10630458 TCTCTCAGGCTCAGTGCTTTAGG + Intergenic
1154187554 18:12199161-12199183 TCTCTCAGGCTCAGTGCTTTAGG - Intergenic
1155554746 18:27006359-27006381 TGTATCAAGTTCATTGGAATTGG - Intronic
1156596180 18:38550746-38550768 TGAATCAGGTTCAGTCTTCTAGG + Intergenic
1157835373 18:50897244-50897266 TGTATCTTTTACAGTGCTATGGG + Intronic
1157874151 18:51256080-51256102 TGTATTAGGTACGGTGCTCTTGG - Intergenic
1166305849 19:41936475-41936497 TGTGTCAGGATCAGTGCAAATGG + Intergenic
926758333 2:16253547-16253569 TGTGTCAGGTACAGTTTTATAGG + Intergenic
927071635 2:19536599-19536621 TGTATCAGCTGCAGTCCTATAGG - Intergenic
928521522 2:32093751-32093773 TGTATCAGGTATAGTGCCAAGGG - Intronic
928806644 2:35165166-35165188 TGTGTCAGGATCAGTGCAAAGGG - Intergenic
929231786 2:39567740-39567762 TCTTTCAGGTTCAGTGGTTTTGG + Intergenic
935442908 2:103122910-103122932 TGTACCAGGTCCTGTGCTGTGGG - Intergenic
936899261 2:117465932-117465954 TGCATCAGCTGCAGTCCTATAGG + Intergenic
944494979 2:200297930-200297952 TGTACCAGGAACTGTGCTATAGG + Intergenic
945618228 2:212100381-212100403 TGTATCAGGTATAGTGATAAGGG - Intronic
948682933 2:239648664-239648686 TCTCTCAGGGTCACTGCTATTGG - Intergenic
1169820520 20:9704637-9704659 TGTCTCAGGTTCAGTGTCCTAGG - Intronic
1169876109 20:10298545-10298567 TGTTTCAGGTTGAGTGGAATGGG - Intronic
1172805029 20:37605669-37605691 TGTCACCTGTTCAGTGCTATGGG - Intergenic
1176334794 21:5586257-5586279 TCTATCTGGTTCAGTGATGTGGG + Intergenic
1176392963 21:6234691-6234713 TCTATCTGGTTCAGTGATGTGGG - Intergenic
1176468456 21:7081483-7081505 TCTATCTGGTTCAGTGATGTGGG + Intronic
1176492017 21:7463261-7463283 TCTATCTGGTTCAGTGATGTGGG + Intergenic
1176508625 21:7675122-7675144 TCTATCTGGTTCAGTGATGTGGG - Intergenic
1182345388 22:29660187-29660209 CGTCGCAGGTTCAGTGCTGTGGG + Intronic
955812991 3:62810928-62810950 TGTATCAGGTTCATTTGAATTGG - Intronic
956064482 3:65382871-65382893 TGTGCCAGGTTCTGTGCTAAAGG - Intronic
960032221 3:113065714-113065736 TGTATCAGCTTGAATGTTATTGG + Intergenic
963405577 3:144859397-144859419 TGCATCAGGTTCAGTTATACAGG + Intergenic
965410431 3:168323391-168323413 TATATAGGGTTCAGTACTATCGG - Intergenic
973676010 4:53263759-53263781 TGCATCAGCTGCAGTACTATAGG + Intronic
976893946 4:90084699-90084721 TGTACCCTGTTCAGTGCTAATGG - Intergenic
976893954 4:90084766-90084788 TGAATCCTGTTCAGTGCTAATGG - Intergenic
980039855 4:127926714-127926736 TGTATCAGGTTCAGTGCTATGGG - Intronic
981058228 4:140388897-140388919 TGTAGCAGCTTCATTGCTATTGG - Exonic
982964987 4:161894991-161895013 TGTCTCAGGTACTGTGCTTTGGG + Intronic
983470793 4:168152019-168152041 TGTAACAGGCACAGTTCTATGGG + Intronic
984926383 4:184810821-184810843 TGTGTCAGGTGCTGTGCTACGGG + Intronic
985078217 4:186239091-186239113 TGTTACAGGTACAGTGATATAGG + Intronic
987357448 5:17076980-17077002 AGTTCCAGGTTCATTGCTATAGG + Intronic
991453688 5:66780007-66780029 TCTATAAGGTACAGTGGTATTGG + Intronic
992413681 5:76532698-76532720 TGTTTCAGGTCCAGTCCTCTAGG - Intronic
994496592 5:100520529-100520551 TGCATCAGCTGCAGTCCTATAGG - Intergenic
997047934 5:130342285-130342307 TCTATCACGTTAAGTGCTTTAGG - Intergenic
997250274 5:132383512-132383534 TGATTCAGGTTCAGTCCTTTTGG + Intronic
998466723 5:142351047-142351069 TGTGCCAGGTTCAGAGCTAAGGG + Intergenic
998601033 5:143585275-143585297 TTTATATGGATCAGTGCTATTGG - Intergenic
1000363158 5:160466758-160466780 TGTACCAGGTTCAGAGATTTGGG + Intergenic
1003246889 6:4389543-4389565 TCCATCAGGGTCAGTGTTATTGG - Intergenic
1004510705 6:16282020-16282042 TCTAGCAGGTTCAGGGCTACTGG - Intronic
1005579808 6:27222887-27222909 TGTTTCAGGTTCAGTCAGATTGG - Intergenic
1006997840 6:38278959-38278981 TGTATCAGATTCAGTGCAAGGGG - Intronic
1008611509 6:53188573-53188595 GCGATCAGGTTCAGTGCTATGGG + Intergenic
1008784343 6:55147601-55147623 TCTCTCAGGTTCAGTACAATAGG + Intronic
1015274058 6:131366394-131366416 TGTTTCAAGTTCAGTGCTGCTGG - Intergenic
1015309310 6:131748445-131748467 TATTTCAGGGTCAATGCTATTGG + Intergenic
1023489974 7:40729263-40729285 TGTATCAGGTACTGTGCTAGAGG + Intronic
1028807254 7:95042271-95042293 TGCATCATGTGCAGTGCAATGGG + Intronic
1031044473 7:116872429-116872451 AGTTTCAGGTTAAGTGCTGTGGG + Intronic
1031261408 7:119525331-119525353 TGCATCAGCTGCAGTCCTATAGG - Intergenic
1035362827 7:158324768-158324790 TGGTTCTGGGTCAGTGCTATGGG - Intronic
1035672951 8:1434066-1434088 TGAATGAGGCTCTGTGCTATGGG + Intergenic
1039097558 8:33903172-33903194 TGTCTCAGGTTCTGTTATATGGG - Intergenic
1040399418 8:47033596-47033618 TGCATCAGCTGCAGTACTATAGG + Intergenic
1041531346 8:58871358-58871380 TGTATGAGGTTAAGTTCTAAAGG - Intronic
1042458357 8:69031911-69031933 TGTATCAGAATCACTGATATGGG - Intergenic
1042768385 8:72352497-72352519 TGTATCAGCTGCAGTAGTATAGG + Intergenic
1046426096 8:114051962-114051984 TGAATCAGATTAATTGCTATAGG + Intergenic
1050740503 9:8814062-8814084 TGTGTCAGGTGCTGTGCTCTGGG - Intronic
1051859057 9:21603663-21603685 TGTAACAAGTCAAGTGCTATAGG + Intergenic
1051910876 9:22153763-22153785 TGTAACAGGTTCTGTGCTAAGGG - Intergenic
1055500745 9:76900202-76900224 TGTTCCAGGTTCTGTGCTAAGGG + Intronic
1055955562 9:81770146-81770168 TGTACCAGGTACTGTGCTAAGGG + Intergenic
1056860856 9:90180357-90180379 TGGATCAGTTTCAGGGTTATGGG - Intergenic
1058500965 9:105615739-105615761 TATATAGGGTTCAGTACTATCGG - Intronic
1059771129 9:117427110-117427132 TGTGTCAGGTATTGTGCTATAGG + Intergenic
1061106776 9:128537011-128537033 TGTCCCAGGTTCTGTGCTAAAGG + Intronic
1186308421 X:8290133-8290155 TGCATCAGCTGCAGTCCTATAGG - Intergenic
1186808720 X:13166150-13166172 TGTGTCAGGTCCAGTGGTAGGGG - Intergenic
1189946043 X:46180119-46180141 TGCATCAGCTGCAGTCCTATAGG + Intergenic
1194967387 X:100304052-100304074 TGTATCAGCTGCAGTACTATAGG - Intronic
1195902366 X:109812424-109812446 TTTACCTGGTTCAGTGCAATAGG - Intergenic
1195960776 X:110383995-110384017 TGTGTCAGGTTCTGTTCTAAAGG - Intronic
1197390971 X:125863923-125863945 TCTATCTGGTCCAGTGCTTTTGG - Intergenic
1198174028 X:134136968-134136990 TGTCTTAGATTCAGTCCTATTGG - Intergenic
1198664778 X:139008328-139008350 TGCATCAGCTGCAGTCCTATAGG - Intronic
1201866581 Y:18662011-18662033 TGTATCAGTTTCTGTGTTAGAGG - Intergenic