ID: 980045765

View in Genome Browser
Species Human (GRCh38)
Location 4:127986726-127986748
Sequence CTTGTCCAAGCCATCATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980045757_980045765 29 Left 980045757 4:127986674-127986696 CCCACCAGCAGTGAATAAACATT 0: 2
1: 46
2: 465
3: 1788
4: 6469
Right 980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 114
980045760_980045765 6 Left 980045760 4:127986697-127986719 CCAATTTTGCCATACTCACCAAC 0: 1
1: 0
2: 1
3: 14
4: 181
Right 980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 114
980045761_980045765 -3 Left 980045761 4:127986706-127986728 CCATACTCACCAACCTTGTACTT 0: 1
1: 0
2: 0
3: 10
4: 134
Right 980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 114
980045758_980045765 28 Left 980045758 4:127986675-127986697 CCACCAGCAGTGAATAAACATTC 0: 1
1: 44
2: 433
3: 1680
4: 6020
Right 980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 114
980045759_980045765 25 Left 980045759 4:127986678-127986700 CCAGCAGTGAATAAACATTCCAA 0: 1
1: 0
2: 10
3: 110
4: 1080
Right 980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980045765 Original CRISPR CTTGTCCAAGCCATCATAGT GGG Intronic
901174625 1:7289900-7289922 CTTGACCAAGCCTTCAGAGAGGG + Intronic
902110258 1:14072453-14072475 CTTGCCCATGCCATCCCAGTTGG - Intergenic
905222261 1:36456283-36456305 CTTCTCAAAGACATCATAGTTGG + Exonic
909730725 1:78885843-78885865 CTTGCTCAAGCCATCAATGTAGG + Intergenic
910049825 1:82960712-82960734 TTTCTCCAAGCCATCACAGCTGG + Intergenic
910489408 1:87752206-87752228 CTTGTCTAAGGTATCATAGTAGG + Intergenic
912791499 1:112656477-112656499 CTTGTCCAGTCCACCATAATGGG - Intronic
913115843 1:115696141-115696163 CTTGCCCAAGCCAGCAGAGTGGG - Exonic
918048941 1:180957667-180957689 CCTGTCCATGCCACCATAATAGG - Intergenic
918323923 1:183391721-183391743 CGTGTCAAAGCCTTCAAAGTGGG + Intronic
922457422 1:225786367-225786389 CTGGGTCAAGACATCATAGTAGG - Intronic
922743972 1:228032854-228032876 TTTGTTCTAGCCATCCTAGTGGG + Intronic
923770386 1:236933192-236933214 TTTCTCCAAGCCATCACAGCTGG - Intergenic
1068338358 10:55667575-55667597 CTTCTCGATGCCATCATATTTGG + Intergenic
1070757149 10:79000425-79000447 CGTGTGCCAGCCATCATTGTGGG - Intergenic
1072846762 10:98840059-98840081 CTTGTCCAAGGCCTTATAGTTGG + Intronic
1073339567 10:102734837-102734859 CTGGTCCATGCCAGCATCGTTGG + Intronic
1075397055 10:122134919-122134941 CTTGTCCCAGGCTCCATAGTAGG + Intronic
1076205491 10:128597152-128597174 CTTCTCCAAGAGATCCTAGTCGG + Intergenic
1078973553 11:16444478-16444500 CTTATCCTTGCCATTATAGTGGG - Intronic
1079114803 11:17634349-17634371 CTTGTCCTATCCATCAGGGTTGG - Intronic
1080432029 11:32208240-32208262 CTTGTCCAAGATATCACAGCTGG + Intergenic
1080994101 11:37579619-37579641 TTTCTCCAAACCATCATAGCTGG - Intergenic
1082051129 11:47771182-47771204 CTTGTCTAAGCCTTCATATCTGG - Intergenic
1082095635 11:48127149-48127171 CTTGTGCAAGGCATCATGGGGGG - Intronic
1084440461 11:69169876-69169898 CTGGGCCAGGCCATCATTGTGGG - Intergenic
1086215056 11:84369237-84369259 CTTATCCCAGCCACCACAGTTGG + Intronic
1086880300 11:92146136-92146158 TTTTTTCAAGCCAGCATAGTTGG + Intergenic
1093447678 12:19279367-19279389 CTGGTCCAAGAGATCATACTTGG - Intronic
1093495607 12:19753515-19753537 CTTGTGCAAGCAATCATATATGG + Intergenic
1095324011 12:40865014-40865036 TTTATTAAAGCCATCATAGTGGG + Intronic
1096607824 12:52779098-52779120 CTTGTCCAAGGCCTAAAAGTTGG - Intergenic
1100593357 12:96050308-96050330 CTTTTCCAATCCATCATTGATGG - Intergenic
1103242658 12:119427849-119427871 CAGGTTCAAGCCATCATACTTGG - Intronic
1107219888 13:37969858-37969880 TTTCTCCAAGCCATCACAGCTGG - Intergenic
1110740451 13:78990024-78990046 CTTCTTCAAGCCATCAAAGTTGG + Intergenic
1112829960 13:103437253-103437275 CTTGTCCAGGCCATCATTTAGGG - Intergenic
1114353912 14:21886482-21886504 CCTGCCCAAGCCATCATTGATGG + Intergenic
1118302827 14:64630560-64630582 CTTGCCCAAGACCACATAGTTGG + Intergenic
1118617239 14:67582456-67582478 CTTGGCTAAGACCTCATAGTTGG - Intronic
1119156840 14:72419375-72419397 CTTGTCCAAGCTCTCATAGCTGG + Intronic
1120539110 14:85733290-85733312 TTTCTCCAAGCCATCACAGCTGG - Intergenic
1120969112 14:90192620-90192642 CTTTTCCAAGCCCTCCCAGTGGG - Intergenic
1121557372 14:94848644-94848666 CTTGTCCAAGCCATCCTATCAGG + Intergenic
1121712384 14:96048407-96048429 CTTTTCCAGGGTATCATAGTTGG + Intronic
1122286101 14:100653830-100653852 CTTGTCCAAGGCCACATAGTTGG + Intergenic
1123015940 14:105375630-105375652 TTTGTTCCAGCCATCCTAGTGGG - Intronic
1124859371 15:33423671-33423693 ATTGTCATAGCCATCCTAGTGGG + Intronic
1124947695 15:34285517-34285539 TTTTTCCAAGCCAGCTTAGTAGG + Intronic
1125410674 15:39402744-39402766 CTTTTCCAAGCTATCATGGGAGG - Intergenic
1125816099 15:42586076-42586098 CTTGAACAAGACATCAAAGTTGG + Intronic
1126016400 15:44355443-44355465 CTTCTTGAAGCCATCATATTTGG - Intronic
1127196587 15:56592129-56592151 CTTGTCCAAACCATCAAGGTGGG + Intergenic
1128775974 15:70320935-70320957 CATGTCCAACACATCCTAGTTGG - Intergenic
1129341791 15:74891154-74891176 CTAGTCCAAGTCTTCATAGATGG + Intronic
1131504272 15:93002172-93002194 TTTTTCCAAGCCATCATCCTAGG - Exonic
1133497224 16:6330435-6330457 CTTTTCAAAGCCTTCATAGTGGG - Intronic
1134064388 16:11218187-11218209 CTTGCCCAAGGCATCACAGCAGG + Intergenic
1136182309 16:28562082-28562104 TTTGGCCAGGCCATCATCGTGGG + Intronic
1137763651 16:50960869-50960891 CTGGTCCAAGCTAGCCTAGTGGG + Intergenic
1138414981 16:56866502-56866524 CTTGTCCAAGGCCACATAGTTGG - Intronic
1142830051 17:2542105-2542127 AGTGTCCATGCCATCATGGTAGG + Intergenic
1148430330 17:47637869-47637891 CCTGTTCTAGGCATCATAGTTGG + Intergenic
1150939311 17:69673117-69673139 CTTGTTCAAGGCATCCAAGTTGG + Intergenic
1152427183 17:80224793-80224815 CTTGTTCATGCCTTCATACTTGG + Intronic
1160130716 18:76222660-76222682 CTTGTGCAAGCCATCAAACAGGG + Intergenic
1162604144 19:11694299-11694321 CTTGTTCAGGCCATCATGGAAGG - Intergenic
1165730811 19:38143445-38143467 CTTGCCCAGGCCACCACAGTGGG + Intronic
1167211891 19:48138775-48138797 TTTGTCCAAGCCAATGTAGTTGG + Intronic
1167917760 19:52755994-52756016 TTTCTCCAAGCCATCACAGCTGG + Intergenic
925881502 2:8356629-8356651 GTTGTTCCAGCCATCTTAGTTGG + Intergenic
931026025 2:58114308-58114330 TTTCTCCAAGCCATCACAGCTGG - Intronic
932097953 2:68868517-68868539 TCTGTTTAAGCCATCATAGTAGG - Intronic
934523369 2:95033634-95033656 TGGGTGCAAGCCATCATAGTTGG - Intronic
938610645 2:132944523-132944545 CTTGTCCAAGGCCACATAGCTGG + Intronic
938810062 2:134844631-134844653 TTTGATCAAGCCATCCTAGTAGG - Intronic
940476668 2:154170564-154170586 CTTGTAGAAGCAATCATATTAGG - Intronic
940757986 2:157705076-157705098 CTTTTCCAAGCCAGCAGAGAGGG - Intergenic
946893642 2:224301481-224301503 TTTCTCCAAGCCATCACAGCTGG + Intergenic
947947632 2:234120184-234120206 TTTTTCCAAAGCATCATAGTTGG - Intergenic
1174741540 20:53019411-53019433 CTTGTCCCAGCAGTCACAGTGGG - Intronic
1177030767 21:15980514-15980536 TTTCTCCAAGCCATCACAGCTGG - Intergenic
1180652914 22:17393678-17393700 CTGGTTCTAGCCATCCTAGTTGG + Intronic
950214078 3:11145481-11145503 CTTTTCCAGGCTCTCATAGTGGG + Intronic
958719534 3:97827000-97827022 CTTTGCCAAGGCAGCATAGTGGG + Intronic
959664164 3:108903098-108903120 ATTGTCCTTGCCGTCATAGTGGG - Intergenic
965458480 3:168932139-168932161 TTTCTCCAAACCATCATAGCTGG - Intergenic
973230117 4:47831203-47831225 CATGTCCAAACCATCAGAGCTGG - Intronic
974544867 4:63289366-63289388 CTTAGCCAAGCCATCATATGTGG - Intergenic
980015800 4:127648990-127649012 CTAGTTCAAGCCTTCACAGTTGG + Intronic
980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG + Intronic
983056171 4:163101200-163101222 TTTCTCCAAGCCATCACAGCTGG - Intergenic
986368421 5:7057823-7057845 TTTCTCCAAGCCATCACAGCTGG - Intergenic
988207820 5:28163093-28163115 TTTGTCCAAACCACCATTGTGGG - Intergenic
989216938 5:38914605-38914627 TTTGTCCAATCCATCATTGATGG - Intronic
990543168 5:56794781-56794803 TTTTTTCTAGCCATCATAGTGGG + Intergenic
992082876 5:73251725-73251747 CTTGACCAACCCATCTAAGTAGG - Intergenic
994653254 5:102556477-102556499 TTTGTCCAATCCATCATTATAGG - Intergenic
995416756 5:111921630-111921652 TTTGGACAAGCCTTCATAGTAGG + Intronic
999428261 5:151505607-151505629 CATGTCAGAGCCCTCATAGTTGG + Exonic
1001763670 5:174227725-174227747 CTTGTCCAACCCATCAGGGGAGG - Intronic
1004310953 6:14544438-14544460 CTTGTGCCAGGCAACATAGTAGG + Intergenic
1012675520 6:102107287-102107309 TTTCTCCAAGCCATCACAGCTGG + Intergenic
1015736873 6:136410404-136410426 CTTGTCAAAGCAACCTTAGTAGG + Intronic
1020532346 7:9354306-9354328 TTTTTCCAAGCCATCACAATTGG - Intergenic
1023555445 7:41417493-41417515 CTTGTCCTTGCCCTCATGGTTGG - Intergenic
1026133537 7:67640043-67640065 TTTGTCCAATCCATCATTGATGG - Intergenic
1028795947 7:94904517-94904539 CATGTCCAAGCCATGAGTGTAGG + Intergenic
1029133940 7:98355085-98355107 CTTGGCCACTCCATCGTAGTAGG + Exonic
1029500623 7:100927136-100927158 TTTCTCCAAGCCATCACAGCTGG + Intergenic
1030883251 7:114907216-114907238 TTTATCTTAGCCATCATAGTAGG - Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1048181041 8:132194507-132194529 CTTAACCAATCCATCCTAGTGGG - Intronic
1048763830 8:137825494-137825516 TTTCTCCAAGCCATCACAGCTGG - Intergenic
1050870679 9:10564965-10564987 TTTAGCCAAGCCATCATTGTTGG - Intronic
1052163542 9:25293272-25293294 TTTCTCCAAGCCATCACAGCTGG + Intergenic
1052769244 9:32672191-32672213 CTTGCTGAAGCCCTCATAGTAGG - Intergenic
1055821379 9:80268540-80268562 CTTGTCCAATCCACCATTGATGG - Intergenic
1057528197 9:95821020-95821042 CTTGCCAAAACCATGATAGTGGG + Intergenic
1059655197 9:116351651-116351673 CTTGACCAAGTTATCATAGTTGG - Intronic
1059920095 9:119150680-119150702 CTGGTCCAAACCATCATGGTTGG + Intergenic
1060855068 9:126908544-126908566 CTTGTCCAAGGCCACATAGATGG + Intergenic
1186891604 X:13964497-13964519 CTTGTTATAGCCATCCTAGTGGG + Intergenic
1187550960 X:20305503-20305525 CTTTTCCAAGCCAAGATGGTTGG - Intergenic
1188916265 X:35914879-35914901 CATTTCCAAGACAGCATAGTTGG - Intergenic
1195113874 X:101676352-101676374 CATGTCCTAGGCATCATTGTAGG + Intergenic
1196206719 X:112948093-112948115 CTTGTCCAAGGTCACATAGTTGG + Intergenic
1197332090 X:125165794-125165816 CATTTTCAAGCCATCATGGTTGG + Intergenic