ID: 980053816

View in Genome Browser
Species Human (GRCh38)
Location 4:128061612-128061634
Sequence CCGTCTCTCCGCCGGGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980053816_980053830 15 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053830 4:128061650-128061672 GGCCTCGGGGCCACCCCGGCTGG 0: 1
1: 1
2: 3
3: 25
4: 263
980053816_980053835 24 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053835 4:128061659-128061681 GCCACCCCGGCTGGGGCGGCTGG 0: 1
1: 1
2: 2
3: 32
4: 1019
980053816_980053826 2 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053826 4:128061637-128061659 AGTCGGGTTCCCTGGCCTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 78
980053816_980053824 0 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053824 4:128061635-128061657 GCAGTCGGGTTCCCTGGCCTCGG 0: 1
1: 0
2: 0
3: 9
4: 139
980053816_980053837 25 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053837 4:128061660-128061682 CCACCCCGGCTGGGGCGGCTGGG 0: 1
1: 1
2: 3
3: 14
4: 226
980053816_980053831 16 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053831 4:128061651-128061673 GCCTCGGGGCCACCCCGGCTGGG 0: 1
1: 1
2: 1
3: 18
4: 434
980053816_980053828 11 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053828 4:128061646-128061668 CCCTGGCCTCGGGGCCACCCCGG 0: 1
1: 0
2: 2
3: 52
4: 450
980053816_980053833 17 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053833 4:128061652-128061674 CCTCGGGGCCACCCCGGCTGGGG 0: 1
1: 1
2: 3
3: 27
4: 183
980053816_980053823 -6 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053823 4:128061629-128061651 AGACGGGCAGTCGGGTTCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 66
980053816_980053825 1 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053825 4:128061636-128061658 CAGTCGGGTTCCCTGGCCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 239
980053816_980053838 26 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053838 4:128061661-128061683 CACCCCGGCTGGGGCGGCTGGGG 0: 1
1: 1
2: 1
3: 31
4: 454
980053816_980053834 20 Left 980053816 4:128061612-128061634 CCGGTGTCCCGGCGGAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 980053834 4:128061655-128061677 CGGGGCCACCCCGGCTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980053816 Original CRISPR CCGTCTCTCCGCCGGGACAC CGG (reversed) Intronic
900155225 1:1201186-1201208 CGGCCTCTCCGCCGCGACCCCGG + Intergenic
900379042 1:2374549-2374571 CCTTCTCTCTGCAGGGACAGTGG - Exonic
900590211 1:3456098-3456120 CCCTCCCTCCACCTGGACACTGG + Intronic
900682360 1:3924026-3924048 CCATCTCCCCTCTGGGACACAGG - Intergenic
900990670 1:6096844-6096866 CCCTCTCTCCCCGGAGACACTGG - Intronic
901442899 1:9290392-9290414 CCTTCTCTCCTCCAGGACGCTGG - Intergenic
902336549 1:15757978-15758000 CGGCCTGTCCCCCGGGACACCGG + Intronic
902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG + Intergenic
906069639 1:43007581-43007603 CCGCCCCGCCGCCGGCACACTGG + Intergenic
916792373 1:168136226-168136248 CCTTCTCCCAGCCGGGACTCAGG - Intronic
917737742 1:177936072-177936094 CCCTCTCTCCCCATGGACACAGG + Intronic
920504768 1:206507940-206507962 GCCTCGCTCCGCCGGGACTCTGG - Exonic
923612021 1:235504281-235504303 CTCCCTCTCCGCCGGGACGCGGG - Exonic
1063101420 10:2953034-2953056 CCGCCTCTTCGCCTGGTCACAGG + Intergenic
1072926220 10:99619957-99619979 CCGGCTCTCAGCCGGGATCCTGG + Intronic
1076116778 10:127906832-127906854 CAGCCACTCCGCCGGGACCCAGG - Intergenic
1079167105 11:18054943-18054965 TCGTCTCTGCGCCTGTACACTGG - Intergenic
1080802075 11:35618562-35618584 CCGCCTCGCCGCCGGGACCCGGG + Exonic
1091154599 11:133361525-133361547 CTGTCTGCGCGCCGGGACACGGG - Intronic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1099956120 12:89353730-89353752 CCGTCTCCCCGCTTGGGCACGGG + Intergenic
1103517320 12:121515760-121515782 TCCTCTCTCCGCCTGCACACTGG + Intronic
1104989162 12:132615501-132615523 CCCACTCTCCCCTGGGACACGGG + Intergenic
1104989188 12:132615592-132615614 CCCACTCTCCCCCGGGACACAGG + Intergenic
1120715660 14:87838418-87838440 CTGTCTTTCCGCTGGGACATGGG - Intronic
1123224039 14:106883494-106883516 CCGTCTCTGCGCCGCGCCGCCGG + Intergenic
1125871494 15:43106078-43106100 CTGTCTCTCCGACCGGCCACAGG - Exonic
1130550922 15:84889421-84889443 CCGTCTCTCTGCCTGGGCAGGGG + Intronic
1131515788 15:93075720-93075742 CCGTCTCCCGGCAGGGACACTGG - Intronic
1142113548 16:88344788-88344810 CGGTCTCGCCTCTGGGACACGGG - Intergenic
1142465365 17:134107-134129 CCGTCTCTGCGCCGCGCCCCCGG - Intergenic
1143001219 17:3796459-3796481 CCGTCTCCCCTCTGGGACATGGG + Intronic
1143119229 17:4596846-4596868 CCGTCTCTCCGCAGGGGGAAAGG + Exonic
1147934981 17:44006093-44006115 CCGTCTCCCCGATGGGGCACAGG - Exonic
1152638258 17:81438985-81439007 CCCTCTGTCCACCAGGACACGGG - Intronic
1153199607 18:2634886-2634908 CCATCCCTCTGCTGGGACACTGG - Intergenic
1160424315 18:78769712-78769734 CCGGCTCTCAGCAGGGACATCGG + Intergenic
1160941352 19:1621794-1621816 CGGCCTCTCCGAGGGGACACTGG - Intronic
1161041717 19:2113973-2113995 TCCTCACTCCGCCGGGGCACAGG + Intronic
1161355770 19:3818995-3819017 CCGGCTCTCAGCCAGGACAGAGG - Intronic
1162040772 19:7969740-7969762 CCTTCTCTCCGCTGGGCCGCAGG - Intronic
1165393542 19:35551619-35551641 GAGGCTCTCCGCCGGGACTCAGG - Intronic
1167524984 19:49978014-49978036 ACGTCGCTGCGCCGGGAGACAGG + Intronic
926170602 2:10550549-10550571 CCTCCTCTCCACAGGGACACTGG - Intergenic
926956063 2:18301678-18301700 CCATCTCTCAGCAGGGACATTGG + Intronic
934165239 2:89288362-89288384 CTGTCTCACAGCCAGGACACAGG + Intergenic
934202035 2:89894100-89894122 CTGTCTCACAGCCAGGACACAGG - Intergenic
935401281 2:102662987-102663009 CCGCCTCTCCTCTGGAACACTGG + Intronic
942241194 2:173964945-173964967 CCGTCTCCCCGCCAGGCCCCGGG - Intronic
944903612 2:204240710-204240732 CCGTATCTCCTCCGTGAGACTGG - Intergenic
948807658 2:240459924-240459946 CCCTGGCTCCGCCCGGACACAGG - Intronic
1173800491 20:45891701-45891723 CCGTCTTTCCGCCAGTACTCCGG + Exonic
1176549099 21:8213801-8213823 CCGACGCTCCGTCGGGAGACGGG - Intergenic
1176556992 21:8258022-8258044 CCGACGCTCCGTCGGGAGACGGG - Intergenic
1176568031 21:8396839-8396861 CCGACGCTCCGTCGGGAGACGGG - Intergenic
1176575934 21:8441059-8441081 CCGACGCTCCGTCGGGAGACGGG - Intergenic
1179033043 21:37736650-37736672 CCATCTCCCCATCGGGACACTGG - Intronic
1181566700 22:23743058-23743080 CCGTGACTCAGCCTGGACACCGG - Exonic
1183453050 22:37906806-37906828 TGGTCCCTCCGCGGGGACACTGG + Intronic
1184512919 22:44943524-44943546 CCGTCTCCTCGTGGGGACACGGG + Intronic
1203253984 22_KI270733v1_random:130117-130139 CCGACGCTCCGTCGGGAGACGGG - Intergenic
1203262040 22_KI270733v1_random:175196-175218 CCGACGCTCCGTCGGGAGACGGG - Intergenic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
963808571 3:149752132-149752154 CCGTTTCTCTCCCGGGAGACAGG + Intronic
964850729 3:161093533-161093555 CCGTCCCTCCCCTGGGACATGGG - Intronic
965216920 3:165875069-165875091 CCCGCTCTCCGCCTGGAAACAGG - Intergenic
968010575 3:195271343-195271365 CCATTTCTCAGCCGGGACAGCGG - Intergenic
980053816 4:128061612-128061634 CCGTCTCTCCGCCGGGACACCGG - Intronic
983048986 4:163021534-163021556 CAGACTCTCCCCTGGGACACAGG - Intergenic
985937081 5:3105818-3105840 CCGCCTCTCCACTGGGACATTGG - Intergenic
985972183 5:3387193-3387215 CCGTCTCTCGGCCAGGTCCCTGG + Intergenic
986210165 5:5664576-5664598 GAGTCTCTCTGCCGGGACAGAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
999331403 5:150675996-150676018 CCATTTCTCCTCCAGGACACTGG - Intronic
1013572375 6:111441945-111441967 CGGTCACACCCCCGGGACACAGG - Intronic
1017775689 6:157679260-157679282 CCTTCTCTCCTCCGTGACCCAGG + Intergenic
1017775700 6:157679291-157679313 CCTTCTCTCCTCCATGACACGGG + Intergenic
1017775709 6:157679322-157679344 CCTTCTCTCCTCCATGACACGGG + Intergenic
1018892307 6:167990658-167990680 CCGTCTCTGTGCCAGGACTCGGG + Intergenic
1019929701 7:4215360-4215382 CCGACTCTGCGCTGGGCCACGGG + Intronic
1029688750 7:102166398-102166420 CCCTGTCTCTGCAGGGACACAGG + Intronic
1037752771 8:21693466-21693488 CCGTTTCTCTGCCGGGTCCCAGG - Intronic
1041313285 8:56537899-56537921 CCGTCTCTCCTCTGGTACACGGG - Intergenic
1049425001 8:142534039-142534061 CCGTCTCTCCAGGGGGACCCAGG - Intronic
1049789176 8:144465295-144465317 CCGTCGCTCCTCCTGGACCCGGG - Intronic
1059145597 9:111896847-111896869 CCGTCTCGCCGCCGGGCTCCCGG - Exonic
1203470385 Un_GL000220v1:113261-113283 CCGACGCTCCGTCGGGAGACGGG - Intergenic
1203478206 Un_GL000220v1:157233-157255 CCGACGCTCCGTCGGGAGACGGG - Intergenic
1190683696 X:52851731-52851753 CCCTCTCTAGGCTGGGACACAGG - Intergenic
1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG + Intronic
1193665179 X:84307809-84307831 CTGTGTCTCCGCTGGCACACTGG - Intergenic
1198530917 X:137549242-137549264 TCGTCTCTCCTCCGGGAGCCGGG + Intergenic