ID: 980058531

View in Genome Browser
Species Human (GRCh38)
Location 4:128103436-128103458
Sequence TGAATTACCTGCCTTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980058528_980058531 -9 Left 980058528 4:128103422-128103444 CCACCAACAATGAATGAATTACC 0: 1
1: 0
2: 5
3: 37
4: 358
Right 980058531 4:128103436-128103458 TGAATTACCTGCCTTGGTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 117
980058525_980058531 1 Left 980058525 4:128103412-128103434 CCCCATTTTTCCACCAACAATGA 0: 1
1: 0
2: 0
3: 25
4: 249
Right 980058531 4:128103436-128103458 TGAATTACCTGCCTTGGTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 117
980058527_980058531 -1 Left 980058527 4:128103414-128103436 CCATTTTTCCACCAACAATGAAT 0: 1
1: 0
2: 0
3: 38
4: 364
Right 980058531 4:128103436-128103458 TGAATTACCTGCCTTGGTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 117
980058526_980058531 0 Left 980058526 4:128103413-128103435 CCCATTTTTCCACCAACAATGAA 0: 1
1: 0
2: 2
3: 53
4: 331
Right 980058531 4:128103436-128103458 TGAATTACCTGCCTTGGTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980058531 Original CRISPR TGAATTACCTGCCTTGGTAG TGG Intronic
902414833 1:16232434-16232456 TGAATTCCATGCCTGGGCAGAGG + Intronic
902973850 1:20074685-20074707 TGAATGAGCTGTCTTGGGAGTGG - Intronic
903306730 1:22418157-22418179 GGAATTCCCTGTCCTGGTAGGGG + Intergenic
903670347 1:25031563-25031585 TGGATTCCCTGCCATGGTACAGG - Intergenic
906090068 1:43171746-43171768 TCAATTACCTGTCTGGGTATTGG - Intronic
906353445 1:45082892-45082914 TGAATTGGCTGCCTTGGTTCAGG - Intronic
908745834 1:67375670-67375692 TGAAGGACCTGCCTTGGCAGAGG + Intronic
911280675 1:95923965-95923987 TAAATTACTTACCTTGGTAATGG + Intergenic
911579422 1:99617972-99617994 TGAGTAAGCTGCCTTGGAAGTGG + Intergenic
911879487 1:103217185-103217207 AGAATTACCTGCTTTGGCACAGG + Intergenic
916764322 1:167845653-167845675 TGAAGTCCCTGCCTCGGCAGTGG + Exonic
917541284 1:175917027-175917049 TGAGTTACCTGCCCTGCTTGAGG - Intergenic
918348363 1:183627497-183627519 TGGATTATCTGCCTCGGGAGTGG - Exonic
918412722 1:184276986-184277008 TGAATGACCTACCTGGGTGGAGG + Intergenic
921356584 1:214289977-214289999 TGAAGTACCTGCCTTTTCAGGGG + Intronic
923200267 1:231704434-231704456 TGAATAACCTGGGTTGGTAATGG + Intronic
1063242291 10:4183505-4183527 TGAGTTTCCCGCCGTGGTAGTGG + Intergenic
1063287687 10:4708389-4708411 TGTTTTACCTGCCTTGGCAAGGG - Intergenic
1063575384 10:7257354-7257376 TGAAGTCCCTGCCTTGCCAGTGG + Intronic
1069080518 10:64083651-64083673 TGAAGTAGCTGCATTTGTAGGGG - Intergenic
1076341329 10:129748013-129748035 TTGATTACCTGGCTGGGTAGTGG + Intronic
1077875447 11:6301232-6301254 TGAATTGCCTGACTTGAAAGGGG + Intergenic
1078278367 11:9873585-9873607 AGAAGTATCTGCCTAGGTAGAGG + Intronic
1081335109 11:41856043-41856065 TGAGTTACCTGGATTGGTGGGGG - Intergenic
1084509939 11:69597187-69597209 TGGAGTACCTGCCATGGGAGGGG + Intergenic
1087939591 11:104079176-104079198 TTTTTTACCTGCCTTGGTAGTGG - Intronic
1094024021 12:25943210-25943232 TGAATGCCCTCCCTGGGTAGTGG - Intergenic
1099478845 12:83141299-83141321 TGAATAACATGCCATGTTAGGGG - Intergenic
1101669513 12:106855062-106855084 AAAATAATCTGCCTTGGTAGGGG + Intronic
1102196377 12:111028404-111028426 TGAATTGCGTTCCGTGGTAGGGG + Intergenic
1102676587 12:114663742-114663764 GGAATTACCTGCATTGAAAGAGG + Intergenic
1109251492 13:60026107-60026129 TGAATTAGCTGACTAGGTGGAGG - Intronic
1110366795 13:74695860-74695882 TGAAAATCCTGCCTAGGTAGCGG + Intergenic
1113627702 13:111858661-111858683 TGTATTCCCTGCCCTGGGAGGGG + Intergenic
1121732373 14:96195436-96195458 TGAAGCACCAGCCTTGGGAGGGG + Intergenic
1122424128 14:101595906-101595928 AGCATGACCTGCCTTGGCAGGGG + Intergenic
1128012905 15:64315526-64315548 GGAATTACTTGCCTTAGTAAAGG + Intronic
1128636066 15:69303276-69303298 TGAATTACCTTGGTTGCTAGGGG + Intronic
1132693693 16:1192841-1192863 GAAATTGCCTGCTTTGGTAGTGG + Intronic
1132985102 16:2762024-2762046 AGAATGACCTCTCTTGGTAGGGG - Exonic
1134586641 16:15417182-15417204 TGTTTTGCCTGTCTTGGTAGTGG - Intronic
1138049105 16:53757692-53757714 TGATTTACCTGATTTGGTGGAGG + Intronic
1138192943 16:55031532-55031554 TGCAGTCCCTGCCTTGTTAGAGG + Intergenic
1138464199 16:57175386-57175408 TGAATAACATGTCTGGGTAGGGG - Intronic
1139812394 16:69632765-69632787 TGAATTACCTTTCTCGTTAGTGG - Intronic
1149553631 17:57557870-57557892 TGACTTAGCTGCCTTGGTTATGG - Intronic
1152489594 17:80621355-80621377 TTAATTAGCTGCATTTGTAGAGG + Intronic
1155235024 18:23810493-23810515 TGACTTTCCTACCTTGGCAGTGG - Exonic
1155250573 18:23949619-23949641 TGAAGAACCTGACTTGGAAGCGG + Intronic
1158338854 18:56443980-56444002 TCAATTTCCTGCCTTTGAAGGGG + Intergenic
1162792853 19:13072022-13072044 TGAAAAACGTGCCTTGGTATTGG - Intronic
1165075769 19:33279108-33279130 GGAATAACCTGCCCTGGCAGGGG + Intergenic
1165398782 19:35584236-35584258 TGAATTAGCTCCTTTGGTAAGGG - Intergenic
1167953029 19:53043078-53043100 TGAATTACCTTCCTTTGTCAGGG - Intergenic
929311901 2:40435264-40435286 GGAAGTGCTTGCCTTGGTAGTGG - Intronic
930537675 2:52664963-52664985 TGTATTTCCTGACATGGTAGTGG + Intergenic
931441803 2:62295219-62295241 GGAATTACCTGACTTTCTAGGGG + Intergenic
942888368 2:180956504-180956526 TAAATTACCTGTCTTAGGAGAGG + Intergenic
943151847 2:184123550-184123572 TGAATTTCCTGCTTTCCTAGAGG + Intergenic
944014820 2:195022761-195022783 TGAAATACATGCATTGGAAGGGG + Intergenic
945707992 2:213259709-213259731 TGAATGACCTGCCTTATAAGTGG - Intergenic
945934699 2:215891440-215891462 TGAGTGAGCTGCCTTGGAAGTGG - Intergenic
1170973723 20:21141120-21141142 TGTATTAGCTGCTTTTGTAGAGG + Intronic
1171311625 20:24149670-24149692 TGAATTAGGAGCCTTGGAAGAGG + Intergenic
1171415910 20:24980249-24980271 TGAATTCTCTGCCTTGCTGGAGG - Intronic
1177434280 21:21030457-21030479 TGAATGACCTGCCTTTTTAAGGG + Intronic
1184142242 22:42584705-42584727 TTATTTTCCTGCCTTGGCAGAGG - Exonic
951364218 3:21761148-21761170 TGAATGAGCTACCTTGGAAGGGG + Intronic
955562157 3:60203393-60203415 TGACTTACATGCCTTTGTTGAGG - Intronic
955892356 3:63663561-63663583 TGAATGCCCTGCCTTGGGGGTGG + Intronic
956105218 3:65810376-65810398 TGAATTACTTTTCTGGGTAGAGG - Intronic
956339379 3:68204550-68204572 TGAATCACGTGCCTTTGCAGAGG + Intronic
958593365 3:96189670-96189692 TGAAGTAGCTGCCTTGCAAGTGG + Intergenic
960517590 3:118619012-118619034 TGAGTTTTCTGCCTAGGTAGAGG + Intergenic
962448854 3:135494550-135494572 TGTATCACCTCCCTTGGTAAGGG - Intergenic
966101355 3:176272356-176272378 TGAATTATTTGCCTTGGATGAGG + Intergenic
966121248 3:176523327-176523349 TAAATTACCTGACTTGGTATGGG - Intergenic
967635262 3:191793367-191793389 ATAATTTCCAGCCTTGGTAGAGG + Intergenic
967690284 3:192465714-192465736 GAAATTACCTGACTTGGGAGTGG - Intronic
971646567 4:29213879-29213901 TGCATTATCTGTCTTGGTATTGG + Intergenic
973202506 4:47520474-47520496 TGACTTACCTTCCCTGGCAGTGG + Intronic
974516569 4:62921807-62921829 TTAATTACCTGGTGTGGTAGTGG + Intergenic
974824203 4:67105585-67105607 TGAATTACTTGGCTTGGTTCTGG + Intergenic
975580581 4:75903563-75903585 TCATTTAACTGTCTTGGTAGAGG + Intergenic
978042318 4:104083532-104083554 TAAATTAGCTGGCATGGTAGTGG - Intergenic
980058531 4:128103436-128103458 TGAATTACCTGCCTTGGTAGTGG + Intronic
983408475 4:167364391-167364413 TGAAATGCTTGCCTTGTTAGGGG - Intergenic
990613441 5:57482674-57482696 TGAGCTGTCTGCCTTGGTAGTGG - Exonic
990636266 5:57731310-57731332 AGAGTTACCAGCTTTGGTAGAGG + Intergenic
991590393 5:68245623-68245645 TGAAATCCTTGGCTTGGTAGAGG - Intronic
993994493 5:94706209-94706231 TTACTTCCCTGACTTGGTAGGGG - Exonic
995450916 5:112299563-112299585 TGATCTACCTGCCTTGGTGCTGG - Intronic
996716688 5:126593986-126594008 TAATGAACCTGCCTTGGTAGAGG - Intronic
1002177849 5:177411888-177411910 TGAATAAGCTGCCTTGGAAGTGG + Intronic
1002473505 5:179451446-179451468 TGAAATGCCTACCTTGGTGGTGG + Intergenic
1002480590 5:179498263-179498285 TGAAATGCCTACCTTGGTGGTGG - Intergenic
1004829571 6:19462735-19462757 TCATTTTCCTGCCTTGGCAGGGG - Intergenic
1011645380 6:89452730-89452752 TGAATTACCTCACTTGGAAATGG + Intronic
1016446051 6:144132884-144132906 TGAATGCCCTGGCTTGCTAGGGG + Intergenic
1024678116 7:51656307-51656329 TTAATTACCTGACTTGGTTTGGG + Intergenic
1030362433 7:108609013-108609035 AGAATTACCTTCTTTGGGAGTGG + Intergenic
1033130752 7:138743609-138743631 TGAAGTCCCTTCCTTGGGAGAGG + Intronic
1037281611 8:17247476-17247498 TGGTTTACCTCCCTTGGTTGTGG + Intronic
1041820654 8:62028891-62028913 TGAAATACGTGTCATGGTAGTGG + Intergenic
1044245358 8:89937914-89937936 GGAATTAACTTCCTTGGCAGAGG - Intronic
1046336973 8:112803372-112803394 TGAATTATCTGCCTTGTTTGAGG + Intronic
1046702199 8:117414159-117414181 TGAATTATCTTCCTTTGTAAAGG - Intergenic
1048231191 8:132643497-132643519 TGAATTAACTGTGTTGGGAGAGG - Intronic
1048602421 8:135932235-135932257 TGAATGACTGGCCTTGGAAGTGG + Intergenic
1049956158 9:695155-695177 TGAATGGCCTGCCTAGGTTGGGG - Intronic
1051590131 9:18769265-18769287 TGAAGTACCTGCTTTGCTGGAGG - Intronic
1052431859 9:28376579-28376601 TGAATAACCTGTCTTGGTCAAGG - Intronic
1052533987 9:29725076-29725098 TGAATTGCATTCCTTTGTAGAGG - Intergenic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1055634655 9:78264483-78264505 TGACAAACCTGCCTTGGTTGAGG + Intronic
1056690913 9:88808088-88808110 TGAGCTAGCTGCCTTGCTAGAGG + Intergenic
1056725699 9:89113801-89113823 TCAAATATCTGCCTTGGTAGTGG - Intronic
1057527857 9:95818593-95818615 TGAATGAGCTTCCTTGGCAGAGG + Intergenic
1058297472 9:103327061-103327083 TGAATTACCTGCTGTGCTTGAGG + Intergenic
1059116645 9:111605808-111605830 TGAATTACATGGCTGGGGAGAGG + Intergenic
1061674258 9:132206906-132206928 TCAACCACCTGCCTTGGCAGTGG - Intronic
1187242022 X:17522397-17522419 TGAAGAACCTGTCTTGGGAGTGG + Intronic
1193573798 X:83175977-83175999 TGTATTACTTTCCTAGGTAGAGG + Intergenic
1197729731 X:129799253-129799275 TGAATTTCCTGACTTGGGAGGGG - Intergenic
1197927515 X:131662514-131662536 TGAACTACCTGATTTTGTAGAGG - Intergenic