ID: 980065709

View in Genome Browser
Species Human (GRCh38)
Location 4:128186778-128186800
Sequence ACCTCCCGCCGCAGGACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980065707_980065709 -4 Left 980065707 4:128186759-128186781 CCTTGTAGGCATTTTAGAGACCT 0: 1
1: 1
2: 102
3: 224
4: 474
Right 980065709 4:128186778-128186800 ACCTCCCGCCGCAGGACCAGAGG 0: 1
1: 0
2: 0
3: 19
4: 157
980065705_980065709 30 Left 980065705 4:128186725-128186747 CCAAGTGCTCATGTCTAAGACAA 0: 1
1: 0
2: 5
3: 93
4: 347
Right 980065709 4:128186778-128186800 ACCTCCCGCCGCAGGACCAGAGG 0: 1
1: 0
2: 0
3: 19
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980065709 Original CRISPR ACCTCCCGCCGCAGGACCAG AGG Intronic