ID: 980066209

View in Genome Browser
Species Human (GRCh38)
Location 4:128191628-128191650
Sequence GTTCAGCAGGACCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980066209_980066213 5 Left 980066209 4:128191628-128191650 CCTACAGTGTGGTCCTGCTGAAC No data
Right 980066213 4:128191656-128191678 CTCTGATATGGCATCTCTTTTGG 0: 1
1: 0
2: 33
3: 58
4: 252
980066209_980066211 -7 Left 980066209 4:128191628-128191650 CCTACAGTGTGGTCCTGCTGAAC No data
Right 980066211 4:128191644-128191666 GCTGAACAGCCACTCTGATATGG 0: 1
1: 24
2: 71
3: 65
4: 143
980066209_980066215 30 Left 980066209 4:128191628-128191650 CCTACAGTGTGGTCCTGCTGAAC No data
Right 980066215 4:128191681-128191703 GAAATAAAGAGGAGAATTTCAGG 0: 1
1: 0
2: 5
3: 57
4: 532
980066209_980066214 19 Left 980066209 4:128191628-128191650 CCTACAGTGTGGTCCTGCTGAAC No data
Right 980066214 4:128191670-128191692 CTCTTTTGGCTGAAATAAAGAGG 0: 1
1: 0
2: 2
3: 23
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980066209 Original CRISPR GTTCAGCAGGACCACACTGT AGG (reversed) Intronic