ID: 980070115

View in Genome Browser
Species Human (GRCh38)
Location 4:128234900-128234922
Sequence GTAAGATTCTGGGAAGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980070111_980070115 -8 Left 980070111 4:128234885-128234907 CCTTTGGGACTCAATGTAAGATT No data
Right 980070115 4:128234900-128234922 GTAAGATTCTGGGAAGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980070115 Original CRISPR GTAAGATTCTGGGAAGGAGA CGG Intergenic
No off target data available for this crispr