ID: 980071119

View in Genome Browser
Species Human (GRCh38)
Location 4:128243608-128243630
Sequence GGAAATTCTGGCCCTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980071109_980071119 9 Left 980071109 4:128243576-128243598 CCTGGAGCTTGCCCTGAAAAGGA No data
Right 980071119 4:128243608-128243630 GGAAATTCTGGCCCTCTGGGTGG No data
980071107_980071119 10 Left 980071107 4:128243575-128243597 CCCTGGAGCTTGCCCTGAAAAGG No data
Right 980071119 4:128243608-128243630 GGAAATTCTGGCCCTCTGGGTGG No data
980071115_980071119 -3 Left 980071115 4:128243588-128243610 CCTGAAAAGGAACAGGGGCTGGA No data
Right 980071119 4:128243608-128243630 GGAAATTCTGGCCCTCTGGGTGG No data
980071113_980071119 -2 Left 980071113 4:128243587-128243609 CCCTGAAAAGGAACAGGGGCTGG No data
Right 980071119 4:128243608-128243630 GGAAATTCTGGCCCTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980071119 Original CRISPR GGAAATTCTGGCCCTCTGGG TGG Intergenic