ID: 980073809

View in Genome Browser
Species Human (GRCh38)
Location 4:128271754-128271776
Sequence CAGCTGTTCCAAGGGACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980073802_980073809 4 Left 980073802 4:128271727-128271749 CCATCTCAGTACCCAGCTAAACC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 205
980073800_980073809 11 Left 980073800 4:128271720-128271742 CCAGGACCCATCTCAGTACCCAG 0: 1
1: 0
2: 0
3: 22
4: 242
Right 980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 205
980073801_980073809 5 Left 980073801 4:128271726-128271748 CCCATCTCAGTACCCAGCTAAAC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 205
980073803_980073809 -7 Left 980073803 4:128271738-128271760 CCCAGCTAAACCAGAACAGCTGT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 205
980073804_980073809 -8 Left 980073804 4:128271739-128271761 CCAGCTAAACCAGAACAGCTGTT 0: 1
1: 0
2: 1
3: 8
4: 123
Right 980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980073809 Original CRISPR CAGCTGTTCCAAGGGACCCA GGG Intronic
900100903 1:961584-961606 GAGCTGACCCGAGGGACCCACGG - Intronic
900186556 1:1335803-1335825 CAGCTGTGCCCAGGCCCCCAGGG - Exonic
900616435 1:3567660-3567682 CAGGTGCTCCTAGGGACCGAGGG - Intronic
902628701 1:17692035-17692057 CAGCTGTTGAAAGGGGCTCATGG + Intronic
903683229 1:25111664-25111686 CAGGAGTTCAAAGGGAGCCAGGG + Intergenic
903779022 1:25810002-25810024 CAGCTCTTCCCAGGCACCCGTGG + Intronic
903853137 1:26320324-26320346 CAGCTGTTTCAGGGGGCACAGGG - Exonic
903996463 1:27307990-27308012 CAGCTGGTCCTTGGGCCCCAGGG - Exonic
904343156 1:29851124-29851146 CAGTGGTTCTAAGGGTCCCAAGG + Intergenic
905252631 1:36659334-36659356 CACCAGTGCCCAGGGACCCAGGG - Intergenic
908948135 1:69524761-69524783 CAGCTGATTCAAGGGAAACAGGG - Intergenic
909759507 1:79270872-79270894 CACCTTTGCCAAGGGTCCCAGGG - Intergenic
913260201 1:116990855-116990877 CAGCTGTTCCAGGGGCCCGCAGG - Intergenic
913664307 1:121033390-121033412 CACCTATTCCAAGGGGCCAATGG - Intergenic
914015697 1:143816669-143816691 CACCTATTCCAAGGGGCCAATGG - Intergenic
914162086 1:145144339-145144361 CACCTATTCCAAGGGGCCAATGG + Intergenic
914654317 1:149725210-149725232 CACCTATTCCAAGGGGCCAATGG - Intergenic
919411570 1:197250867-197250889 CAGCTCTTCCAGGAGACACAAGG - Intergenic
921294197 1:213686793-213686815 CAGCTGCCCCAAGGGAGCTATGG - Intergenic
922434109 1:225586130-225586152 CAGCTGAGCCAAGGAACTCAAGG + Intronic
923370059 1:233300910-233300932 CAGCTGTTCATGGGGGCCCATGG - Intergenic
924475738 1:244380779-244380801 TTGCTGTTCCCTGGGACCCAGGG - Intronic
924893984 1:248316451-248316473 CAGCTCTGCCAAGGGACAGATGG - Intergenic
1062997820 10:1883368-1883390 CGTCTGTTCCAAGGGGCACAAGG - Intergenic
1063077220 10:2729399-2729421 CAGCTGTAGCCAGGGCCCCATGG + Intergenic
1066714787 10:38275125-38275147 CAGCAGTTCCAATGCACCTAGGG + Intergenic
1066783286 10:38975580-38975602 CAGCAGTTCCAATGCACCTAGGG - Intergenic
1066977838 10:42385857-42385879 TTGCTGTTCCATGGGACCTATGG - Intergenic
1069627510 10:69877278-69877300 CTGTTGTTACAAGGGACCCTTGG + Intronic
1070487595 10:76945417-76945439 CAGCAGTTCCAATGCAGCCAAGG + Intronic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1071776054 10:88789271-88789293 GAGATGTTACAATGGACCCAAGG + Intergenic
1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG + Intergenic
1076132827 10:128025757-128025779 GACCTGCTCCAGGGGACCCAGGG + Intronic
1076357707 10:129865079-129865101 CAGATGTGCCAAGGGACTCAGGG + Intronic
1076706092 10:132302432-132302454 CAGCTGCCCCAAGGGCCCCCAGG + Intronic
1076870101 10:133188811-133188833 CACCTGAACCAAGGGACCCAGGG + Intronic
1077756529 11:5035874-5035896 CTGCTGTACCAAGGACCCCAGGG + Intergenic
1079048171 11:17127822-17127844 AAACTGTCCCAAGGGACACAAGG + Intronic
1080311500 11:30898338-30898360 AAACTGTTCCAATGGTCCCAAGG + Intronic
1080737993 11:35036168-35036190 CAGCTGTTGAAATGGCCCCAAGG - Intergenic
1082835283 11:57646775-57646797 CAGTCCTTCCAAGGGAGCCATGG - Exonic
1082849427 11:57752578-57752600 CAGCTGTTGCAAGGGCCCTGGGG + Intronic
1083094206 11:60233110-60233132 CACCTGCTCCAAGAAACCCAAGG + Intronic
1083431246 11:62614562-62614584 CAGCGGTTCCAAGAGGCCCAGGG - Intronic
1083603285 11:63961888-63961910 CAGCTGTTGCCAGGCATCCAGGG - Intergenic
1085080447 11:73629502-73629524 CAGCTGTTCCAAAGGCCCTGGGG - Intergenic
1089104042 11:115987341-115987363 CAGCCCTTCCCAGGGACACAAGG + Intergenic
1090583758 11:128187875-128187897 CAGATGTTCCAAAGGCTCCATGG - Intergenic
1091727760 12:2857427-2857449 CAGCAGGTCCAAAGGTCCCAAGG + Intronic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1092205579 12:6612859-6612881 CAGCTGTTTGAAGGGGCCCCTGG - Intergenic
1095943428 12:47740512-47740534 CAGAGGCTCCAGGGGACCCAGGG + Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1096089629 12:48890266-48890288 CAGCTCATCCACGGGCCCCAGGG - Intergenic
1098293757 12:68983446-68983468 CAGCTGCTCCAAGAGATCAATGG - Intergenic
1098953405 12:76664931-76664953 CAGCTGTTCCAAAGAATTCAGGG + Intergenic
1099831147 12:87844383-87844405 CAAATGTTCCAAGGGAGCCAAGG + Intergenic
1100172732 12:91994027-91994049 CAACTGTTCAAAGGGAAGCAGGG + Intronic
1100430787 12:94530262-94530284 CACATGTCCCAAGGGACCCCTGG - Intergenic
1101004455 12:100388100-100388122 CAGCAAGTACAAGGGACCCAAGG - Intronic
1101137249 12:101756965-101756987 AAGCTGTTCAGAGAGACCCAGGG - Intronic
1102707922 12:114898283-114898305 CAAGTGTTCCAAGGGGCCCTGGG - Intergenic
1103848824 12:123917971-123917993 AAGGTGTTCCCAGGGACCCTTGG + Intronic
1106421473 13:29589510-29589532 CAGCTGCCCCAAGGACCCCAGGG + Intronic
1107717950 13:43219156-43219178 CAGCTCTTCCCAGGAACCCAGGG - Intronic
1108640900 13:52381412-52381434 CAGGTGTTTTAGGGGACCCATGG - Intronic
1110604482 13:77415691-77415713 CATCTTTTCCAAGGGTCCCTTGG + Intergenic
1112236344 13:97641328-97641350 CATCTATGACAAGGGACCCAAGG - Intergenic
1112807657 13:103180862-103180884 CAGCTCCTCCAAGCGTCCCAGGG + Intergenic
1113464345 13:110503441-110503463 CAGAGGCCCCAAGGGACCCAAGG + Exonic
1113631055 13:111884145-111884167 CACCTGTTCCCAGGGACCCTGGG - Intergenic
1113795100 13:113052303-113052325 CACCTGGTCCCAGGGACCCCCGG - Intronic
1116310005 14:43312823-43312845 CAGCTGCTCCAAGAGACCAAAGG - Intergenic
1118458355 14:65965447-65965469 CAGCTGCTCCAAGGCAGCCCTGG + Intronic
1119707218 14:76790558-76790580 TAGCTGTTCCCAGGGACCTGGGG + Intronic
1122691990 14:103535875-103535897 CGGCAGCTCCAAGGGCCCCATGG - Exonic
1123115829 14:105893652-105893674 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123120071 14:105912367-105912389 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1202909723 14_GL000194v1_random:105456-105478 CAGCTGCTCCAAGAGATCAAAGG - Intergenic
1123402809 15:20003953-20003975 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123512146 15:21010607-21010629 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1128658245 15:69478343-69478365 CACCTGTTACAAGAGACCCTTGG - Intergenic
1129181832 15:73882536-73882558 CAGATCTCCCAAGGGAGCCAGGG + Intronic
1132517202 16:371353-371375 AAGCTCTTCTCAGGGACCCAAGG + Exonic
1134862918 16:17576737-17576759 CATTTGTTTCAAGGGAGCCAGGG + Intergenic
1135424167 16:22324127-22324149 CATCTCTTCCAAGGGGACCATGG - Intronic
1136103482 16:28012137-28012159 CAGCTGCTCCAAATGCCCCACGG + Intronic
1136428783 16:30185434-30185456 CAGCTCCTCCACCGGACCCATGG + Intronic
1136472993 16:30494298-30494320 CTGCTGTTCCAAGAGCCACAGGG + Exonic
1137609485 16:49809318-49809340 CAGCTTTTCCAAGGGCCCCCAGG - Intronic
1137724077 16:50645403-50645425 CAGCTGGTACAAGGGCCTCAAGG + Intergenic
1139306809 16:65993612-65993634 CATCTGTGCCAAGGGTGCCAGGG - Intergenic
1139565176 16:67770627-67770649 CTGCTGATTCAAGGGACCAATGG + Intronic
1139969545 16:70765284-70765306 GAGCAGTTCCAAGGATCCCAGGG - Intronic
1140804854 16:78523781-78523803 CAGCTGTTCCAGAGGCCCCCAGG - Intronic
1141172535 16:81700447-81700469 CAACTGTCCCAAGGGAACCAAGG + Intronic
1142984988 17:3690234-3690256 CAGAGGCTCCAGGGGACCCAAGG - Intronic
1143373843 17:6455880-6455902 CAGCTTCTCCAAGGAACCCTGGG + Intronic
1143508012 17:7380224-7380246 CTGCTGTCCCAAGGGTCCCTTGG - Intergenic
1146845954 17:36182318-36182340 CAGGTGATCCAGGGCACCCAGGG - Intronic
1147033327 17:37659906-37659928 CTGCTTTTCCCAAGGACCCAGGG - Intergenic
1147358727 17:39918054-39918076 CCCTTGTTCCAAGGGGCCCAAGG + Intronic
1148127983 17:45246647-45246669 CAGTTCTCCCAAGGGTCCCAGGG - Intronic
1148777506 17:50104003-50104025 CTGCAGTGCCAAGGGCCCCAGGG - Intronic
1149347987 17:55758004-55758026 GAGCTTTTCTAAGTGACCCATGG - Intronic
1151917962 17:77132644-77132666 AGGCTGTGCCAAGAGACCCAGGG - Intronic
1152190758 17:78885908-78885930 CAGCTGTGCCAAGGTGACCAAGG + Intronic
1153897483 18:9579905-9579927 CAGCTGTTCCTTGGTATCCATGG - Intronic
1155872090 18:31042080-31042102 CAGCCCCACCAAGGGACCCAGGG + Intronic
1156357869 18:36358397-36358419 CAGCTGTTCCCAAAGAGCCAGGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157681761 18:49613057-49613079 CAGCTTTTCCAAGGGACCTGAGG - Intergenic
1160551254 18:79694968-79694990 CAGCTGTTCCACGGGTGGCACGG + Intronic
1160627680 18:80223791-80223813 AGGATGTTCCAAGGGACCAAGGG + Intronic
1161128486 19:2573960-2573982 CAGCTGGTCCGTGGCACCCACGG - Intronic
1161162007 19:2767039-2767061 CAGCTGGTCCCTGGGGCCCAGGG - Intronic
1163602882 19:18259289-18259311 GAGCTGCTCCAAGGGGCCCATGG - Intronic
1165294554 19:34916227-34916249 CAGCTCTTCCAAAGTCCCCAGGG - Intergenic
1165308105 19:35014307-35014329 CAGCAGATCCAAGGGGCCCAGGG - Exonic
1166047229 19:40236581-40236603 CAGCTGTTCCCAGGTACCATGGG - Intronic
1167156940 19:47744316-47744338 CAGCCATTCAAAGGGATCCATGG - Intergenic
1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG + Intronic
926174476 2:10577407-10577429 CTGGTGTTCCAAGGGAGACAGGG - Intronic
929666645 2:43838786-43838808 CTGCTGTCCCAAGGGACTCCGGG - Exonic
932574318 2:72954505-72954527 CAGCTGTTGCAGGGGCCCCTGGG - Intronic
933161205 2:79026750-79026772 CAGCTGTCCCAAAGGCTCCAAGG + Exonic
935214072 2:100962603-100962625 CAGCGGTGCCCAGGGTCCCAAGG + Intronic
937040130 2:118814504-118814526 AACATGCTCCAAGGGACCCAAGG + Intergenic
937213392 2:120293283-120293305 CAGCTGCTCCTAAGGACACAGGG + Exonic
938322267 2:130373117-130373139 CAGCTTCTCCATGAGACCCACGG + Intronic
939436714 2:142186201-142186223 CAGTTGTACCTAGGGACTCATGG + Intergenic
940499423 2:154475819-154475841 CAGCTGCTCCAAGAGAGCAATGG + Intergenic
942198872 2:173551048-173551070 CAGCTGGTACAAAGGCCCCAAGG + Intergenic
943730404 2:191297301-191297323 CAGTTGCTGCAAGGGGCCCACGG + Intronic
946168528 2:217879833-217879855 TAGCTCTGCCATGGGACCCAGGG + Intronic
947072591 2:226307450-226307472 CAGTTGCTCCAGGAGACCCAGGG - Intergenic
949066831 2:241996151-241996173 CAGCTGTGCCATGGGAACCCTGG - Intergenic
1169125355 20:3123654-3123676 CAGCTGTTCCAAAGACCCAATGG + Intronic
1170036573 20:11996070-11996092 CAGCTTTTCCAACAGTCCCAGGG + Intergenic
1171749415 20:29033853-29033875 CAGCATTTCCAAGGTACCAAGGG - Intergenic
1175747479 20:61468238-61468260 CAGCTGGCCCAAGGTGCCCAGGG + Intronic
1176047574 20:63100794-63100816 GAGCTGTTTCTAGGGCCCCAGGG + Intergenic
1176964657 21:15198448-15198470 CAGTTGCTCCAAGGCACCAAAGG - Intergenic
1177940171 21:27400262-27400284 CTGCTGTTCACAAGGACCCAGGG - Intergenic
1178297376 21:31421612-31421634 CAGTTTTTCCCACGGACCCAAGG - Intronic
1178507238 21:33171876-33171898 CAGCAGGTGCCAGGGACCCAAGG + Intergenic
1178830708 21:36054182-36054204 CAGCTGTTCCCTGTGAGCCAAGG + Intronic
1179173960 21:38994012-38994034 CACCTCATCCAAGGAACCCAAGG + Intergenic
1179888570 21:44324927-44324949 CAGCTGTGGCCAGGGACCCACGG - Intronic
1181609587 22:24003728-24003750 CAGATGGTGCAAGGGCCCCAGGG + Intergenic
1184117450 22:42430598-42430620 CTGCTGCTCCAAGGGACTCTAGG + Intronic
950538371 3:13594877-13594899 CAGTTCTTCCAAGGGAAGCAAGG - Intronic
950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG + Exonic
952081188 3:29759433-29759455 AAGCTGTTCTGAGGGACGCAAGG + Intronic
952901513 3:38114716-38114738 CAACTGTGCCAGGGGCCCCAGGG - Intronic
954103698 3:48397875-48397897 CTGGTCCTCCAAGGGACCCAGGG + Intronic
954652299 3:52172478-52172500 AAACTGGTCCCAGGGACCCATGG - Intergenic
954684009 3:52360941-52360963 CAGCTTTGCCCAGGGACCCCTGG - Intronic
956181714 3:66523700-66523722 CACCTGTTCCAAGGGAGGCAGGG - Intergenic
956567115 3:70651585-70651607 TAGATTTTCCAAGGGATCCATGG - Intergenic
957516924 3:81267125-81267147 CAACTGGTACAAGGCACCCAAGG - Intergenic
959213993 3:103425690-103425712 CAGTGGTGCCAAGAGACCCAGGG - Intergenic
967891221 3:194365846-194365868 TAGCCGTTCCATGGAACCCAGGG + Intronic
968628324 4:1637863-1637885 AAGCAGGTCCCAGGGACCCAGGG + Intronic
968704835 4:2072992-2073014 CACCTGTTCCAAGGACTCCATGG + Exonic
974926170 4:68300786-68300808 CAGCTCTCCAAAGGGACCAATGG - Intergenic
977522512 4:98102563-98102585 CAGATGATCAAAGGGACCCAAGG - Intronic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
985543766 5:499146-499168 CGGCTTTTCCCAAGGACCCATGG + Intronic
988732552 5:33987417-33987439 AAACTGTGCCAAGGCACCCAGGG + Exonic
991612826 5:68466432-68466454 CAGCTGTGGCAAAGGGCCCAAGG - Intergenic
993193413 5:84707233-84707255 CAGCAGTCCCTAGGGACACATGG + Intergenic
994368632 5:98945050-98945072 CAGCTGTTCCCATGGACCCAGGG + Intergenic
997711557 5:136008939-136008961 CAGCTGGTCCCAGGCATCCAAGG - Intergenic
999385386 5:151150657-151150679 CAGTTGTACCAAGGGGCCCCTGG - Intronic
999641439 5:153677112-153677134 CAGCTGTTCCCTGGGGCCAAGGG + Exonic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG + Exonic
1006297734 6:33177456-33177478 CACCTGTTTCTAGGGACCCCAGG - Exonic
1006455617 6:34130238-34130260 AGGCTGTTAAAAGGGACCCAGGG + Intronic
1011836320 6:91435800-91435822 CAGAAGTTCCATGTGACCCAAGG - Intergenic
1015561966 6:134525615-134525637 CAGTTGTTACAGGGCACCCAAGG + Intergenic
1015856176 6:137626803-137626825 CAGCTTCCCCAAGGGAGCCACGG + Intergenic
1017881768 6:158567082-158567104 CAGATCTTCCAAGGGCCCCGCGG + Intronic
1018509411 6:164509324-164509346 CTGCTTTTCCAAGCTACCCACGG + Intergenic
1019965006 7:4491402-4491424 CATCTGTTCCATGAGACTCATGG - Intergenic
1022414457 7:30166211-30166233 CATCTGTTCCCAGGCAACCATGG - Intergenic
1023513218 7:40975334-40975356 CAGCTGTGATATGGGACCCAAGG - Intergenic
1023687593 7:42752430-42752452 CAGCTGGTGCAAAGGACCTAAGG - Intergenic
1024533218 7:50409990-50410012 CAGTTGTGCCCGGGGACCCATGG - Intergenic
1025025588 7:55513775-55513797 CAGCTCTTCAAAGGGCCACAGGG + Intronic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1033952005 7:146796480-146796502 CAGCTGGTCCAAAGTACCCCAGG - Intronic
1034232810 7:149546014-149546036 CAGCTGTCCCAAGGGGCCTCAGG - Intergenic
1034462854 7:151207864-151207886 CACCAGCTCCAAGTGACCCAGGG - Exonic
1034844413 7:154431149-154431171 CAGCTGTTCTCAGGGCACCACGG - Intronic
1034987406 7:155524896-155524918 CCACTGTTCTAAGGGGCCCAAGG + Intronic
1035345281 7:158193248-158193270 CAGCTGTCCCATGGGGCCCCTGG - Intronic
1036426014 8:8645852-8645874 CAAATGTGCCAAGGGAGCCAGGG + Intergenic
1036810137 8:11862266-11862288 TATCTGTTCCCAGGGCCCCAAGG - Intronic
1036933969 8:12982864-12982886 CAGCTTCTCCAAGGGACAAAAGG + Intronic
1038090262 8:24245292-24245314 CAGCTGATGCTAAGGACCCAAGG + Intergenic
1040452453 8:47561714-47561736 GAGATGGTACAAGGGACCCAGGG - Intronic
1047795053 8:128246917-128246939 AAGCTGTTCTAAGGAAGCCAAGG - Intergenic
1048450689 8:134530984-134531006 CAGTTGTTCCTAGGCATCCATGG - Intronic
1049354176 8:142179497-142179519 CCAGTGTTCCCAGGGACCCAGGG - Intergenic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1050358311 9:4804218-4804240 CAGCAGTTCCTTGGGACCCAGGG + Intronic
1050880620 9:10695605-10695627 CAGTTGTTTAAAGTGACCCAGGG + Intergenic
1051391856 9:16573669-16573691 CAGCTGCTCCCTGGTACCCAGGG - Intronic
1055375901 9:75648165-75648187 CAGCTGCTGCCAGGGCCCCAGGG - Intergenic
1057501032 9:95596767-95596789 CAGCTGCTCCCAGGGTCCCTGGG + Intergenic
1057780467 9:98045808-98045830 CAGCTGCTCCAAGAGATCAATGG - Intergenic
1059976316 9:119721644-119721666 CCGCTGTTCCAAGGGAGTGAAGG - Intergenic
1061919746 9:133776282-133776304 CATCTGTTCCATCAGACCCACGG - Intronic
1061971377 9:134047270-134047292 CAGCTCTTCCCAGGGCCGCACGG + Intronic
1187723168 X:22173180-22173202 CAGCTCTTTCAAGGGACCCCTGG + Intronic
1191216131 X:57933968-57933990 CAGCTGCTCTAAGGTCCCCACGG - Intergenic
1191638066 X:63399790-63399812 CAGCTGCTCCAAGAGAACAATGG + Intergenic
1192135842 X:68599478-68599500 CTGCTGCTCTAAAGGACCCATGG + Intergenic
1194052059 X:89081101-89081123 CAGCTGCTCCAAGAGATCAATGG + Intergenic
1195683387 X:107565007-107565029 CAGCTGTTCCGGGAGAACCAGGG + Exonic
1196279944 X:113812388-113812410 CAGCTGGTCTGAGGGACCCCAGG + Intergenic
1198163501 X:134030687-134030709 TAGCTATTCCAAGAGACCCCAGG + Intergenic
1200237974 X:154478344-154478366 CATCTGGTGCCAGGGACCCATGG + Exonic