ID: 980075481

View in Genome Browser
Species Human (GRCh38)
Location 4:128288562-128288584
Sequence CTGCCGATGCCAGAGAAGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980075481_980075487 28 Left 980075481 4:128288562-128288584 CCGGGCTTCTCTGGCATCGGCAG 0: 1
1: 0
2: 0
3: 18
4: 155
Right 980075487 4:128288613-128288635 CAGCCACTCCCCGCTGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 154
980075481_980075482 -2 Left 980075481 4:128288562-128288584 CCGGGCTTCTCTGGCATCGGCAG 0: 1
1: 0
2: 0
3: 18
4: 155
Right 980075482 4:128288583-128288605 AGTCTACGTGCTCCTCGCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 13
980075481_980075484 22 Left 980075481 4:128288562-128288584 CCGGGCTTCTCTGGCATCGGCAG 0: 1
1: 0
2: 0
3: 18
4: 155
Right 980075484 4:128288607-128288629 ACCGAGCAGCCACTCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 77
980075481_980075486 23 Left 980075481 4:128288562-128288584 CCGGGCTTCTCTGGCATCGGCAG 0: 1
1: 0
2: 0
3: 18
4: 155
Right 980075486 4:128288608-128288630 CCGAGCAGCCACTCCCCGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980075481 Original CRISPR CTGCCGATGCCAGAGAAGCC CGG (reversed) Exonic
900241856 1:1621044-1621066 CTGCCGCTGTCACAGAAGCCTGG + Intronic
900357370 1:2271331-2271353 CTGTCCAGGCCAGAGAAACCAGG + Intronic
900599562 1:3497241-3497263 CAGCCGGAGCCAGTGAAGCCAGG + Exonic
901703249 1:11056563-11056585 CTGCAGCTGCCAGAAAACCCTGG + Intronic
903189541 1:21649073-21649095 ATGCTGATGCCAGGGAAGCCCGG + Intronic
906108226 1:43307243-43307265 CAGCGGGTGCCAGTGAAGCCAGG - Exonic
906130326 1:43451842-43451864 CTGCCGCTGTAAGAGAAGCCAGG + Exonic
906142886 1:43544215-43544237 CTGCCCTTGCCCCAGAAGCCCGG - Intronic
907524524 1:55046500-55046522 CTGCAGAAGCCAGAGAGGCCGGG - Intronic
909717580 1:78728068-78728090 CTCCCTCTGCCAGCGAAGCCTGG - Intergenic
911435853 1:97856840-97856862 CTGCCAATGCCAGAGATACCAGG - Intronic
913490058 1:119370766-119370788 TTGCCGTAGACAGAGAAGCCAGG + Intronic
918466294 1:184824609-184824631 CTGACGATGCTGGAGATGCCAGG + Intronic
920234331 1:204493046-204493068 CTGCCGATCCCAGAGCAGACAGG - Intronic
920704947 1:208244023-208244045 TTGCTGATGTCAGAGGAGCCCGG - Exonic
921673366 1:217950951-217950973 CCGCAGATGCCAGGGAACCCTGG - Intergenic
924756286 1:246944323-246944345 CTGCACATGCTTGAGAAGCCTGG + Intergenic
1062858118 10:789674-789696 GTGTCAGTGCCAGAGAAGCCCGG - Intergenic
1067087560 10:43250901-43250923 CTGCTGAAGCCAGAGACACCTGG + Intronic
1067469094 10:46523361-46523383 CTGCAGATGCCCGAGACCCCAGG - Intergenic
1067518330 10:46974242-46974264 CTGCTGGAGCCAGAGCAGCCAGG + Intronic
1067643919 10:48077586-48077608 CTGCTGGAGCCAGAGCAGCCAGG - Intergenic
1067858447 10:49818956-49818978 CCGCAGATGCCAGCGATGCCAGG - Intronic
1071067716 10:81656291-81656313 CCCCAGATGCCAGAGGAGCCAGG - Intergenic
1071365733 10:84898904-84898926 TTGCAGATGGCACAGAAGCCTGG + Intergenic
1072213480 10:93268332-93268354 CTGCCTGTGCCTGAGAACCCTGG + Intergenic
1072730538 10:97842970-97842992 TTGCAGACGGCAGAGAAGCCAGG - Intergenic
1074182262 10:111075961-111075983 CTGCAGATCCGAGAGAGGCCAGG - Intergenic
1074182797 10:111078254-111078276 CGGCCGAGGCCAGAGACACCAGG - Exonic
1076533729 10:131162319-131162341 CTGACCATGGCATAGAAGCCAGG + Intronic
1080502883 11:32887172-32887194 CTGCAGCTTCCAGAGAAGCAGGG + Intergenic
1081340161 11:41917919-41917941 CTGCTGAAGCCAGGGAAGCTGGG - Intergenic
1084173694 11:67412542-67412564 CTGCCCCTGCCAGGAAAGCCTGG - Intronic
1085031213 11:73271979-73272001 CTCCAGACTCCAGAGAAGCCAGG + Intronic
1085556200 11:77424343-77424365 CTGCCTATGCCCCAGAAGCAAGG + Intronic
1090205620 11:124882450-124882472 CTGCCAATCCCAGAGAGTCCAGG - Intergenic
1091012605 11:132018827-132018849 CTTCCGAAGTCACAGAAGCCTGG + Intronic
1091141596 11:133239770-133239792 CTGGAGATGCCAGAGAAAGCGGG + Intronic
1091236398 11:134025122-134025144 CTGCCCCTGCCAATGAAGCCGGG + Intergenic
1091271270 11:134313398-134313420 CTGCCGATACCTGAGGATCCTGG + Exonic
1092178307 12:6426380-6426402 CTGGTGATGTCAGAGAAGCCTGG - Intergenic
1095729536 12:45491643-45491665 CTGCCCCTGCCAGAGCTGCCAGG + Intergenic
1096045859 12:48561554-48561576 CTGTCGATGTCTGAGAAGCATGG - Intergenic
1097180864 12:57171141-57171163 CTGCCGCTCCCAGATAAGCTGGG + Intronic
1097643136 12:62205664-62205686 CTGCTGATGCCAGGGAAACTGGG - Intronic
1105543947 13:21338412-21338434 CTGCTGCTGTCAGAGATGCCAGG - Intergenic
1105892867 13:24694597-24694619 CTGCCGATGACAGAGATTACCGG - Intronic
1110031572 13:70620995-70621017 CTGCGCATGCCAGGGAAGCATGG - Intergenic
1113054841 13:106257077-106257099 CTTCCATTCCCAGAGAAGCCAGG + Intergenic
1113180559 13:107620527-107620549 CTGCCAATACCAGGGAATCCAGG - Intronic
1115797582 14:36956228-36956250 CTGCCAAAGCCAGAGCAGACGGG - Intronic
1117546188 14:56796430-56796452 CTGCAGGTGCCAGGGAAGCCAGG - Intergenic
1120834986 14:89031202-89031224 CTGCCCATCCCAGGGAAGGCAGG - Intergenic
1122075016 14:99230399-99230421 CTGCCCCTGCCACAGAAACCAGG + Intronic
1124207077 15:27730309-27730331 CTGCAGAGGCCAGGGAAGCTCGG - Intergenic
1125599113 15:40906122-40906144 CTGTCCCTGCCAGGGAAGCCTGG - Intergenic
1127391196 15:58506332-58506354 GTGCCCATGCCAAAGAAGACTGG - Intronic
1128885121 15:71279613-71279635 CTGCAGAGGCCCAAGAAGCCAGG - Intronic
1131236698 15:90703033-90703055 CTCCCAATTCCAGAGATGCCTGG - Intergenic
1134207834 16:12252313-12252335 CTGGAGTTGCCAGAGAAGTCTGG + Intronic
1139675514 16:68520595-68520617 GTGACAAAGCCAGAGAAGCCTGG + Intergenic
1139949807 16:70663343-70663365 CTGCCCATGACAGAGGGGCCAGG - Exonic
1140204817 16:72925075-72925097 CTGCCAATGCCAGTGATACCTGG + Intronic
1141564354 16:84891408-84891430 CTGCCGATGGCAGAGTCACCGGG - Intronic
1142627122 17:1199212-1199234 CTGCAGGTGCCAGGGAAGACTGG + Intronic
1142795349 17:2303317-2303339 CTCCCGATGCCTGGGAATCCGGG + Intronic
1145741848 17:27281374-27281396 CTGCCGTGGGCAGAGAAGCCAGG + Intergenic
1145961961 17:28892092-28892114 CTTCCCAGGTCAGAGAAGCCCGG - Intronic
1146161993 17:30565048-30565070 CTGGCGAGCACAGAGAAGCCCGG + Intergenic
1146454010 17:32995520-32995542 CTGCCGCCGGCATAGAAGCCAGG + Exonic
1147675076 17:42199764-42199786 CTGCTGAGGACAGAGCAGCCAGG - Exonic
1148116505 17:45178388-45178410 CTGGGGAGGCCAGGGAAGCCAGG - Intergenic
1148540635 17:48477615-48477637 CTGCCCATGTCAGAGAATACAGG - Intergenic
1148866814 17:50633079-50633101 CTGCCTAGGCCATAGAAGCCTGG + Intergenic
1149771551 17:59326132-59326154 CTGCATATTACAGAGAAGCCAGG + Intergenic
1150407022 17:64910471-64910493 CTGCCGAGGGCAGAGATGCAGGG + Intronic
1150749626 17:67848263-67848285 CTGCCGAGGGCAGAGATGCAGGG - Intronic
1152376662 17:79922173-79922195 CTGCCGCTGCCAGGGGAGCCGGG + Intergenic
1152383544 17:79954976-79954998 CTGCCGTGGCCACAGAAGACTGG + Intronic
1152889730 17:82873686-82873708 CTGCCGATGCGCGGGGAGCCTGG + Intronic
1154411181 18:14143058-14143080 TTGCAGATGCCTCAGAAGCCAGG - Intergenic
1157562732 18:48660101-48660123 CTGCCATTCCCAGAGGAGCCTGG - Intronic
1157626124 18:49052654-49052676 CTGGCGATACCTGAGCAGCCGGG - Intronic
1160670262 19:359046-359068 CTCCAGATGCCAGAAAAGGCGGG + Intergenic
1162966888 19:14160358-14160380 CTGCACAGGCCAGGGAAGCCGGG - Intronic
1165923626 19:39314099-39314121 GTGGCGATGTCAGAGGAGCCGGG + Exonic
1167680355 19:50916478-50916500 CAGCCTCAGCCAGAGAAGCCAGG + Intergenic
1168434466 19:56306283-56306305 CTGGCGATGCGGGAGAGGCCAGG - Intronic
925196883 2:1932911-1932933 CTGCTGAAGCCAGGGAAGCCTGG + Intronic
925926011 2:8671218-8671240 CTGCCCATGCCAGAACGGCCAGG - Intergenic
926306446 2:11640399-11640421 CCGCCAATGCCAGGGAAGACCGG + Exonic
927414811 2:22868105-22868127 CTGCTGATACCAGAGAAACGAGG + Intergenic
930959113 2:57237389-57237411 GTGCCAATGCCAGTGAACCCAGG + Intergenic
934659622 2:96136308-96136330 CTGCCTCAGCCAGAGATGCCCGG - Intronic
943032102 2:182697698-182697720 CTGCCTATAGCAGAGAAGCTGGG - Intergenic
1168803039 20:655684-655706 CTGCCCATTCCAGAGGTGCCAGG + Intronic
1171986471 20:31664855-31664877 CTGCCAAGGCCAGAGTGGCCTGG - Exonic
1173666489 20:44766839-44766861 CTTCAGGGGCCAGAGAAGCCTGG - Intronic
1175894546 20:62330296-62330318 CTCCCGTTCCCAGAAAAGCCTGG - Intronic
1179341780 21:40517983-40518005 CTGCAGAGGCCAGAAAAGCATGG - Intronic
1179632070 21:42684750-42684772 CAGCCGATGCCACAGACGTCAGG + Intronic
1180259562 21:46659647-46659669 CTGCCACTGCCAGGCAAGCCTGG - Intronic
1181476073 22:23168563-23168585 CAGCAGATGGCAGAGGAGCCTGG - Intergenic
1183255336 22:36758118-36758140 CTGCCGGTTCCAGGGCAGCCGGG - Intergenic
1183346690 22:37312046-37312068 CTGCCGAGGCCAGAAAATCAAGG + Exonic
1183389307 22:37535901-37535923 CAGCCCATGGCAGAGAAGCAGGG - Intergenic
1184512714 22:44942751-44942773 CTGCCACTCCCAGGGAAGCCTGG - Intronic
1184595122 22:45509274-45509296 CTGCCGGGGCCAGAGCTGCCTGG + Intronic
949577406 3:5352141-5352163 ATGCAGGTGGCAGAGAAGCCAGG - Intergenic
950585941 3:13892308-13892330 CTGGGGCTGCCAGAGGAGCCTGG - Intergenic
955409990 3:58649191-58649213 CTGCAGGTGCCAGAGAAACCTGG - Intronic
956401476 3:68884335-68884357 CTGCCAAAGACAGAGAAGGCGGG - Intronic
956701631 3:71964312-71964334 AAGCCATTGCCAGAGAAGCCAGG - Intergenic
960944630 3:122957747-122957769 CTGCCACTGCCAGTGAAGCTGGG + Intronic
961086100 3:124068661-124068683 CTGGAGATGATAGAGAAGCCTGG + Intergenic
961330354 3:126134656-126134678 CTCCAGAGGCCAGAAAAGCCGGG - Intronic
961339848 3:126210818-126210840 CTCCCCCTGGCAGAGAAGCCTGG - Intergenic
962709875 3:138077354-138077376 GTGCAGATGCCAGAGGAGCCCGG + Intronic
962737746 3:138340691-138340713 CTGCAGATGCCAGAGTAGACAGG - Intergenic
963795535 3:149627511-149627533 CTGGAAATGCCAGAGAAGCCAGG + Intronic
965521191 3:169669284-169669306 CTGCCGCGGCCAAAGAAACCAGG - Intergenic
967705485 3:192645096-192645118 CTGCTGAAGCCAAAGAAGCTTGG + Intronic
969497707 4:7535396-7535418 ATGCCCCAGCCAGAGAAGCCAGG - Intronic
973259564 4:48148586-48148608 CAGAAGATGCCAGATAAGCCAGG - Intronic
975489834 4:74976262-74976284 CTGCTGGTGCCAGGGAAGCTGGG + Intronic
975690513 4:76958211-76958233 GTGGCGATGGCAGAGAAGCCTGG - Intronic
975844645 4:78511923-78511945 ATACAGGTGCCAGAGAAGCCAGG - Intronic
977032517 4:91904072-91904094 CTGCCGATGCCTCAGACTCCAGG + Intergenic
980075481 4:128288562-128288584 CTGCCGATGCCAGAGAAGCCCGG - Exonic
980134582 4:128847252-128847274 CTGATGATGGCGGAGAAGCCAGG - Intronic
980973258 4:139586666-139586688 CTCCCCATTCCAGACAAGCCAGG + Intronic
982137004 4:152281563-152281585 CTGCCTATGTCAGAGATGGCTGG - Intergenic
982343733 4:154333119-154333141 CTGTCGATGGCAAAGACGCCTGG + Exonic
985762547 5:1757726-1757748 ATGCAGATGCCACAGCAGCCAGG + Intergenic
985890268 5:2709973-2709995 CTTCAGATGCAAAAGAAGCCTGG - Intergenic
986209602 5:5658504-5658526 CTCCCGAACCCAGGGAAGCCTGG + Intergenic
991390215 5:66134729-66134751 CTGCCCATGCTACAGAAGCATGG - Intergenic
992388957 5:76312819-76312841 CTGCCGATCCCTGAGAGTCCTGG + Intronic
996747471 5:126857662-126857684 CAGCCAATGCCAGGGAGGCCAGG - Intergenic
1000386074 5:160675846-160675868 CAGCTGAGGCCAGAGAAGCAGGG + Intronic
1000540670 5:162535667-162535689 CTCCCGTTGCCACAAAAGCCAGG + Intergenic
1001239123 5:170054888-170054910 CCTTCGAGGCCAGAGAAGCCAGG - Intronic
1002169562 5:177367516-177367538 CTGCCGAGGCGCGAGGAGCCAGG - Exonic
1003408141 6:5839968-5839990 CTGCTGCTGTCAGAGATGCCAGG + Intergenic
1007224473 6:40303141-40303163 CTGCCAGTCACAGAGAAGCCTGG - Intergenic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007739937 6:44004120-44004142 CTGACGATGACAGAGAAGAGGGG - Exonic
1013454691 6:110319909-110319931 CTTCCTAGGCCAGAGGAGCCCGG - Intronic
1015933293 6:138383947-138383969 CTGCCCAGGACAGAGAGGCCAGG - Intergenic
1017838783 6:158204658-158204680 CTGCCACTGCCAGAGGAGTCTGG + Intergenic
1019499279 7:1356238-1356260 CTGCAGATCCCGGAGGAGCCTGG - Intergenic
1023903618 7:44505152-44505174 CTCCCGATGCCTGAGACTCCAGG + Intergenic
1026943574 7:74302604-74302626 CTGCAGGTGCCAGAGAAGTTGGG + Intronic
1028098341 7:86790144-86790166 CTGAAGATGCCAGATAAGGCAGG - Intronic
1034544443 7:151780811-151780833 CTGCAGTTTCCAGAGAAGGCTGG + Intronic
1036654827 8:10671395-10671417 CAGCCCCTGCCAGAGGAGCCTGG + Intronic
1047112516 8:121806420-121806442 GTGCCCATGCCAGAGATGCAGGG + Intergenic
1047401723 8:124553815-124553837 CTGAAGATGGTAGAGAAGCCTGG - Intronic
1047764506 8:127979627-127979649 AGGCCAATGCCAGAGGAGCCTGG + Intergenic
1049333692 8:142070291-142070313 CTGCCGCTGCCAGGGCAGCCTGG - Intergenic
1049415160 8:142491704-142491726 CTGGTGATGTCAGAGCAGCCAGG - Intronic
1057869597 9:98708283-98708305 CTGCCGAGGGCAGAGAGGGCTGG - Intronic
1058101152 9:100918943-100918965 CTGCAGATGCCACAGATGACAGG + Intergenic
1061329867 9:129885661-129885683 CTGCTGCTGCCAGAGAAGGATGG - Intergenic
1061461941 9:130746967-130746989 CTCCAGAAGCCAGAGAGGCCAGG - Intronic
1061509174 9:131049981-131050003 CTCCCTCTGCCAGAGAGGCCGGG + Intronic
1062026779 9:134344227-134344249 ATGCCGGTGCCAGAGGAGGCTGG - Intronic
1062142583 9:134967767-134967789 CCGCAGATGCCCGAGGAGCCTGG - Intergenic
1062143156 9:134971366-134971388 CTGCCCTTGCCAGTGTAGCCAGG - Intergenic
1192247997 X:69389070-69389092 TTGCCGATGGCAGTGTAGCCAGG - Intergenic
1192543275 X:71992981-71993003 CTGTCGCTGCCAGAGCACCCTGG - Intergenic
1195213111 X:102669633-102669655 CTGCCAGTGCTAGAGAAGCTGGG - Intergenic
1199899854 X:152162289-152162311 CTGCTGGTGCCATTGAAGCCTGG + Intergenic
1200059314 X:153477191-153477213 CTGGCTGTGCCAGAGAAACCTGG + Intronic