ID: 980076748

View in Genome Browser
Species Human (GRCh38)
Location 4:128302054-128302076
Sequence TAGCAACCTCTGCTCCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980076748_980076751 -5 Left 980076748 4:128302054-128302076 CCTCCAAGGAGCAGAGGTTGCTA No data
Right 980076751 4:128302072-128302094 TGCTAACTCAATTGCCTAGGAGG No data
980076748_980076752 -1 Left 980076748 4:128302054-128302076 CCTCCAAGGAGCAGAGGTTGCTA No data
Right 980076752 4:128302076-128302098 AACTCAATTGCCTAGGAGGCCGG No data
980076748_980076750 -8 Left 980076748 4:128302054-128302076 CCTCCAAGGAGCAGAGGTTGCTA No data
Right 980076750 4:128302069-128302091 GGTTGCTAACTCAATTGCCTAGG No data
980076748_980076753 0 Left 980076748 4:128302054-128302076 CCTCCAAGGAGCAGAGGTTGCTA No data
Right 980076753 4:128302077-128302099 ACTCAATTGCCTAGGAGGCCGGG No data
980076748_980076756 21 Left 980076748 4:128302054-128302076 CCTCCAAGGAGCAGAGGTTGCTA No data
Right 980076756 4:128302098-128302120 GGTAGATTCAGTCAGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980076748 Original CRISPR TAGCAACCTCTGCTCCTTGG AGG (reversed) Intergenic