ID: 980087195

View in Genome Browser
Species Human (GRCh38)
Location 4:128403623-128403645
Sequence CTGTGTACCTAGAAGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980087193_980087195 -9 Left 980087193 4:128403609-128403631 CCAGGTCACTGGAGCTGTGTACC No data
Right 980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG No data
980087192_980087195 -8 Left 980087192 4:128403608-128403630 CCCAGGTCACTGGAGCTGTGTAC No data
Right 980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980087195 Original CRISPR CTGTGTACCTAGAAGGATTA TGG Intergenic
No off target data available for this crispr