ID: 980093071

View in Genome Browser
Species Human (GRCh38)
Location 4:128462375-128462397
Sequence AATGATGTGCAGGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980093066_980093071 21 Left 980093066 4:128462331-128462353 CCACAGTCTGTATTTAGAAACTT No data
Right 980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980093071 Original CRISPR AATGATGTGCAGGAGGTGGG TGG Intergenic
No off target data available for this crispr