ID: 980097822

View in Genome Browser
Species Human (GRCh38)
Location 4:128511580-128511602
Sequence CCTTATATGCAGAGGTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980097817_980097822 -4 Left 980097817 4:128511561-128511583 CCTTGTGGAGAAGACTTGACCTT 0: 1
1: 0
2: 0
3: 20
4: 187
Right 980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG 0: 1
1: 0
2: 5
3: 47
4: 388
980097816_980097822 10 Left 980097816 4:128511547-128511569 CCTTGCTGGAGAGACCTTGTGGA 0: 1
1: 4
2: 15
3: 60
4: 313
Right 980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG 0: 1
1: 0
2: 5
3: 47
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980097822 Original CRISPR CCTTATATGCAGAGGTAGAG GGG Intergenic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
904292308 1:29495926-29495948 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
904875571 1:33652054-33652076 CAGTATCTTCAGAGGTAGAGAGG + Intronic
906303658 1:44702399-44702421 CCTTTTTTGAAGAGGCAGAGTGG - Intronic
912304665 1:108555152-108555174 CCTTAAATTGAGAGGAAGAGAGG - Intergenic
917280475 1:173374333-173374355 CCATAGATGGGGAGGTAGAGGGG - Intergenic
918154179 1:181829990-181830012 CCATAGATGGGGAGGTAGAGGGG - Intergenic
921022023 1:211244548-211244570 CCCTATATGCAGGGGTGGTGGGG + Intergenic
923816954 1:237390738-237390760 ACATATATGCAAAGGGAGAGTGG - Intronic
1063513205 10:6667466-6667488 CCTGAAATGCAGTGGAAGAGGGG - Intergenic
1064396100 10:14983335-14983357 CCTAATATCCAGAGGGGGAGAGG + Intronic
1064396880 10:14989567-14989589 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1064396893 10:14989642-14989664 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1064399811 10:15012112-15012134 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064836214 10:19533920-19533942 CATTTAATGCAGAGGAAGAGAGG + Intronic
1065231447 10:23602732-23602754 CCTTTCATGGAGAGGTAGAAAGG - Intergenic
1068500893 10:57839150-57839172 CCATAGATGGGGAGGTAGAGGGG - Intergenic
1069569090 10:69483719-69483741 GCATCTATGCAGAGGTTGAGCGG + Exonic
1070425160 10:76279955-76279977 CATTAAATGCAGAGGTTGATTGG - Intronic
1071018754 10:81028135-81028157 CAATCTATGCAGAGGAAGAGTGG - Intergenic
1071068789 10:81667820-81667842 CCTAATAGGCAGAGGAATAGTGG - Intergenic
1072611565 10:97020662-97020684 CTTTATGTGCAGGGGTACAGCGG - Intronic
1072641877 10:97217297-97217319 CATTATATGGAGAAGTAGAGTGG + Intronic
1077032273 11:473883-473905 CTTTATTTGCAGAGGTATTGTGG + Exonic
1079038707 11:17042705-17042727 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1079038733 11:17042819-17042841 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1080562712 11:33478636-33478658 CTTTATATGGACAGATAGAGTGG + Intergenic
1081448208 11:43149847-43149869 CCTAATATCCAGAGGAGGAGAGG - Intergenic
1081448622 11:43152707-43152729 CCTAATATCCAAAGGTAGAGAGG + Intergenic
1081448737 11:43153380-43153402 CCTAATATCCAGAGGGGGAGTGG + Intergenic
1081449879 11:43160969-43160991 CCTAATATCCAAAGGCAGAGAGG + Intergenic
1081450827 11:43169494-43169516 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1081451161 11:43171996-43172018 CCTAATATCCAAAGGTAGAGAGG + Intergenic
1082168380 11:48971695-48971717 CCTAATATTCAGGGGTGGAGAGG - Intergenic
1082608761 11:55275227-55275249 CCTAATATTCAGGGGTGGAGAGG + Intergenic
1082612591 11:55319550-55319572 CTTTATATGTAGAGTGAGAGTGG + Intergenic
1082936734 11:58663624-58663646 CCTAATATCCAAAGGGAGAGAGG - Intronic
1082936807 11:58664117-58664139 CCTAATATCCAGGGGGAGAGAGG - Intronic
1084132329 11:67145821-67145843 CCTGAAAGGCAGAGTTAGAGAGG - Intronic
1084227374 11:67725623-67725645 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084260804 11:67977395-67977417 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084262113 11:67985908-67985930 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1084547888 11:69823468-69823490 CCTTATAAGAAGAGGTAATGAGG - Intergenic
1084807776 11:71590995-71591017 CCTAATGTGCAGGGGAAGAGAGG - Intronic
1084811849 11:71616797-71616819 CCTAATATCCACAGGGAGAGAGG - Intergenic
1084811863 11:71616872-71616894 CCTCATATCCAGAGGGCGAGAGG - Intergenic
1084844934 11:71891243-71891265 CCTAATATCCACAGGGAGAGAGG - Intronic
1084847661 11:71912979-71913001 CCTAATGTGCAGGGGAAGAGAGG - Intronic
1084847698 11:71913207-71913229 CCTAATATCCACAGGGAGAGAGG - Intronic
1085596064 11:77811179-77811201 CCTTATTTACAAAGATAGAGAGG + Intronic
1085859053 11:80210942-80210964 CTTTCTTTCCAGAGGTAGAGGGG + Intergenic
1086701841 11:89907286-89907308 CCTAATATTCAGGGGTGGAGAGG - Intergenic
1086704327 11:89937239-89937261 CCTAATATTCAGGGGTGGAGAGG + Intergenic
1086911671 11:92479573-92479595 CCTTATCTACAGAGGCAGAATGG - Intronic
1087682751 11:101234201-101234223 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1088747388 11:112815600-112815622 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1088759109 11:112912676-112912698 CCTTGTATGCAGTGGTAAGGAGG + Intergenic
1092294685 12:7189100-7189122 CCCATTATGCAGAGGTGGAGAGG + Intronic
1092432035 12:8417796-8417818 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1092432051 12:8417871-8417893 CCTAATATCCACAGGGAGAGAGG + Intergenic
1092435558 12:8444385-8444407 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1092436197 12:8448732-8448754 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1095697602 12:45158454-45158476 CCTAATATTCAGGGGTGGAGAGG + Intergenic
1095810445 12:46368956-46368978 CTTTATATTTAGAGGTATAGAGG - Intronic
1096506467 12:52097015-52097037 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096506890 12:52099377-52099399 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1096506913 12:52099475-52099497 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1096508686 12:52114759-52114781 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508698 12:52114833-52114855 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508738 12:52115062-52115084 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1097433201 12:59532000-59532022 CTTTATATCCAGGGGAAGAGAGG + Intergenic
1097434365 12:59541053-59541075 CCTAATATCCAGGGGTGGAGAGG + Intergenic
1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG + Intergenic
1097436310 12:59554074-59554096 CCTAATATTTAGAGGGAGAGAGG + Intergenic
1098467826 12:70808119-70808141 GCTTTTATGCAGATGTAGATAGG + Intronic
1098479519 12:70942762-70942784 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1098970165 12:76846098-76846120 TATTATGTGCAGAGGTAGAGAGG + Intronic
1099181412 12:79475338-79475360 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1099376833 12:81902882-81902904 CCATAGATGGGGAGGTAGAGGGG - Intergenic
1099533408 12:83816202-83816224 CCTTATAAGAAAAGGAAGAGAGG - Intergenic
1099656351 12:85497196-85497218 TCTTATAAGCAAAGGTACAGAGG - Intergenic
1106789792 13:33143017-33143039 CCTCACATGCAGAGAGAGAGAGG - Intronic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1107102845 13:36612693-36612715 GTTTATATGCAGTTGTAGAGGGG + Intergenic
1107545069 13:41427507-41427529 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1107548260 13:41454054-41454076 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1107548466 13:41455169-41455191 CCTAATATCCAGGGGAAGAGAGG - Intergenic
1107548518 13:41455473-41455495 CCTACTATCCAGAGGGAGAGAGG - Intergenic
1108360779 13:49666327-49666349 CCTTATATGTGGAAGCAGAGTGG + Intronic
1108817962 13:54314225-54314247 CCTAATATTCAGAGGCGGAGAGG - Intergenic
1108818190 13:54315984-54316006 CCTAATATGCGGAGGTGCAGAGG + Intergenic
1109354975 13:61224099-61224121 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1109355669 13:61228551-61228573 CCTTATATCCAGGGGTGCAGAGG - Intergenic
1109355961 13:61230206-61230228 CCTAATATCCAGAAGGAGAGAGG - Intergenic
1109409595 13:61945313-61945335 CCTAATATGCAGGGACAGAGAGG + Intergenic
1109433414 13:62267009-62267031 CCTTATCTGCAGAGGCCAAGTGG - Intergenic
1109840942 13:67915403-67915425 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1111810127 13:93089193-93089215 CCTAATATCCGGAGGTGGAGAGG + Intergenic
1111810502 13:93092047-93092069 CCTCATATTCAAAGGTGGAGAGG + Intergenic
1111810634 13:93092797-93092819 CCTTATATCGAGAGGGAGATAGG + Intergenic
1111810682 13:93093034-93093056 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1111811156 13:93096020-93096042 CCTAATATCCGGAGGTGGAGAGG + Intergenic
1111967865 13:94879288-94879310 CCTTTTATGAAGGGCTAGAGTGG - Intergenic
1112506423 13:99979064-99979086 CCTTTTATGCACAGAGAGAGGGG + Intergenic
1113253412 13:108479794-108479816 CCTCATATGCATAGGTTGATTGG - Intergenic
1113285230 13:108839176-108839198 CTTTATAAGAAGAGGAAGAGAGG - Intronic
1114437020 14:22714854-22714876 CCTAATATCCAGAGCGAGAGAGG + Intergenic
1114600425 14:23951863-23951885 CCTTCTCTTCAGAGGTAGACAGG - Intergenic
1116516904 14:45815421-45815443 CCTAATATTCAGAGGGAGATAGG + Intergenic
1116517425 14:45818534-45818556 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1116517906 14:45821765-45821787 CCTAATATACAGTGGAAGAGAGG + Intergenic
1116519297 14:45830752-45830774 CCTAATATCCAGTGGGAGAGAGG + Intergenic
1116519437 14:45831682-45831704 CCTAATATCCAGAGGGAGATAGG - Intergenic
1116756994 14:48960607-48960629 CTTTATAGGAAGAGGTTGAGAGG + Intergenic
1117037414 14:51743276-51743298 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1117037827 14:51745310-51745332 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1117039123 14:51753723-51753745 CCTAATATCCACAGGGAGAGAGG - Intergenic
1117039137 14:51753798-51753820 TCCTATATTCAGAGGGAGAGAGG - Intergenic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1120324404 14:83007034-83007056 CCTTATAAGAGGAGGAAGAGAGG - Intergenic
1120552799 14:85891865-85891887 CTTTATAAGAAGAGGAAGAGGGG - Intergenic
1120825117 14:88948028-88948050 CCTTATATGCACAGGCACACCGG + Intergenic
1121111664 14:91317080-91317102 CCTTATTTTTAGAGGAAGAGGGG - Intronic
1122728978 14:103780930-103780952 CCTTTTAGGCAAAGGTAAAGGGG + Intronic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1124399792 15:29338223-29338245 CCTTATATGCAGAGGGGCTGTGG - Intronic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1130188739 15:81711776-81711798 CCTTATATCCAAAGGTAGAGAGG + Intergenic
1131411547 15:92211947-92211969 CCATAAATGGGGAGGTAGAGGGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135852189 16:25973932-25973954 GCTTGTTTGCAGAGGGAGAGGGG - Intronic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1137365138 16:47853602-47853624 GCTTTTATGCAGAGGTAAACAGG + Intergenic
1140710225 16:77670682-77670704 CCTTATACGAGGAGGAAGAGAGG + Intergenic
1140895545 16:79321410-79321432 CATTTTATCCAGAGGAAGAGAGG + Intergenic
1141316473 16:82967252-82967274 CCTAAAATGTGGAGGTAGAGGGG - Intronic
1141999658 16:87656949-87656971 CCTTATAAGAAGAGGAGGAGAGG - Intronic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1148533118 17:48414365-48414387 CATCATATGCAGAGGTCCAGAGG + Intronic
1151355287 17:73554439-73554461 CCTTATAAGCAGAGGAGGTGAGG + Intronic
1152283910 17:79401536-79401558 CCTTCAGTGCAGAGGGAGAGGGG + Intronic
1153125219 18:1783489-1783511 ACTTATATCCAGAGGTTGAATGG - Intergenic
1156513211 18:37659048-37659070 CCTCCACTGCAGAGGTAGAGAGG + Intergenic
1157028800 18:43879613-43879635 CCCTATTTGCAGAGGAAGAAAGG - Intergenic
1160612817 18:80101723-80101745 CCTTATAAACAGAGGTCCAGGGG + Intergenic
1162236847 19:9316197-9316219 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1166237040 19:41464246-41464268 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1166237636 19:41468076-41468098 CCTAATATCCAGCGGTGGAGAGG - Intergenic
1166237791 19:41469065-41469087 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1166238256 19:41472171-41472193 CGTAATATCCAGAGGTAGAGAGG - Intergenic
1166244074 19:41513506-41513528 CCTAATATCCAGAGTAAGAGAGG - Intergenic
1166245157 19:41519902-41519924 CCTAATATCCAGGGGTAAAGAGG - Intergenic
1166245753 19:41524423-41524445 CCTAATATCCAGCGGTGGAGAGG - Intergenic
1166245920 19:41525511-41525533 CCTAATATCCAGTGGAAGAGAGG - Intergenic
1166656615 19:44616865-44616887 CCATATATGTAGAGAGAGAGAGG + Intronic
1166972168 19:46576314-46576336 CCTTATAGGAAGAGGAAGAGAGG - Intronic
1167677621 19:50897252-50897274 CCTAATATGAAGAGGAAAAGAGG + Intergenic
1167685388 19:50952746-50952768 CCTTATTTCCCCAGGTAGAGAGG + Exonic
925916297 2:8609019-8609041 CCTTATAAAAAGAGGGAGAGAGG - Intergenic
927006370 2:18853599-18853621 CCTTCTATCCAGAGGTTGAATGG + Intergenic
932350293 2:71025714-71025736 CCTAACATCCAGAGGGAGAGAGG - Intergenic
932353724 2:71051542-71051564 CCTAATATCCAGGGGAAGAGAGG - Intergenic
932353767 2:71051771-71051793 CCTAATATCCACAGGGAGAGAGG - Intergenic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
933456482 2:82525877-82525899 CCTCATATCCAGAGGGTGAGTGG - Intergenic
933456929 2:82529151-82529173 CCTAATATGCAAGGGGAGAGAGG + Intergenic
934569849 2:95362404-95362426 CCTTATATGAAGAGTAAGAGAGG - Intronic
936273229 2:111068359-111068381 CCTTATATGCTGTGGTGAAGAGG + Intronic
936506466 2:113111832-113111854 CCTTACTTGCAGAGGCAAAGAGG + Intronic
936557829 2:113511546-113511568 CCTAATATTCAGAGGCCGAGAGG + Intergenic
937749170 2:125453831-125453853 CCTTATATTCTAAGGGAGAGAGG - Intergenic
940871640 2:158865521-158865543 CCTAATATCCAGAGGGGGAGAGG - Intergenic
940872514 2:158871411-158871433 CCTAATATCCACAGGGAGAGAGG - Intergenic
940872528 2:158871486-158871508 CCTAATATCCAGAGGGAGAGAGG - Intergenic
940873734 2:158881127-158881149 CCTAATATCCACAGGGAGAGAGG - Intergenic
940873750 2:158881202-158881224 CCTACTATCCAGAGGGAGAGAGG - Intergenic
940874672 2:158887166-158887188 CCTAATATCCAGGGGAAGAGAGG - Intergenic
940874711 2:158887395-158887417 CCTAATATCCACAGGGAGAGAGG - Intergenic
940874726 2:158887470-158887492 CCTAATACCCAGAGGGAGAGAGG - Intergenic
941533173 2:166693820-166693842 CCTAATATCCAGAGGGAGAGAGG - Intergenic
943842409 2:192599335-192599357 CCTAATATTCAGAGGCCGAGAGG - Intergenic
943945713 2:194060568-194060590 CATTAAATGCAGAGGTGGTGAGG + Intergenic
944677750 2:202048357-202048379 CCTTATGGGAAGAGGAAGAGAGG + Intergenic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945279149 2:208018884-208018906 CTTTATATGTAGATATAGAGTGG - Intronic
946887458 2:224237096-224237118 CCTTATGAGAAGAGGAAGAGAGG - Intergenic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
948204797 2:236157838-236157860 TCTTAGATTCAGAGGCAGAGGGG - Intergenic
948368214 2:237472368-237472390 CATTTTAGGCAGAGGTACAGGGG + Intergenic
1169598983 20:7235417-7235439 TCTTTTATGCAGAGGATGAGTGG - Intergenic
1170001505 20:11619728-11619750 CAATAGATGCAGAGGTATAGTGG - Intergenic
1170095963 20:12646375-12646397 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1170235611 20:14101682-14101704 CCTTAAAAGCAGAGATACAGGGG - Intronic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1172310830 20:33917211-33917233 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1172784221 20:37455726-37455748 CCTTAAAAGAAGAGGAAGAGAGG + Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173701535 20:45076108-45076130 CCTTACACACAGGGGTAGAGGGG + Exonic
1176919689 21:14673097-14673119 TCCTATTTGGAGAGGTAGAGTGG - Intergenic
1177298279 21:19205238-19205260 CAACATATGCAGAGGTAAAGCGG - Intergenic
1178224316 21:30698266-30698288 CTTTATTTGCAGAGGAGGAGGGG - Intergenic
1179671788 21:42954470-42954492 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1180608519 22:17080145-17080167 CTTTATATGAAGAGGAAGATAGG - Intergenic
1182773175 22:32810626-32810648 CCTCATGGGCAGAGGCAGAGGGG - Intronic
1183116005 22:35693293-35693315 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183116951 22:35699667-35699689 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183117426 22:35702667-35702689 CCTCATATCCAGGGGAAGAGAGG - Intergenic
1183753751 22:39739639-39739661 CCTATTATGAAGAAGTAGAGAGG - Intergenic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
949704172 3:6796891-6796913 CATTATATACAGATGTATAGGGG + Intronic
949883066 3:8676564-8676586 CCTAATATTCAGAGGCCGAGAGG - Intronic
949884894 3:8684979-8685001 CCTAATATCCACAGGGAGAGAGG - Intronic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
952557353 3:34547894-34547916 CATTACATGTGGAGGTAGAGAGG + Intergenic
952567053 3:34671118-34671140 CCTTATAGGCAAGGGGAGAGTGG + Intergenic
953705641 3:45227816-45227838 CCTGATATGCAAAGGTTGAAAGG - Intergenic
954231719 3:49222960-49222982 CCATAGATGGAGAGGTAGATGGG + Intronic
954655695 3:52192826-52192848 CCTTCTATACAGTGGTAGATGGG - Intergenic
955735188 3:62031463-62031485 CATGATATGGAGAGGTAGACAGG + Intronic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
957044068 3:75360690-75360712 CCTAATATCCACAGGGAGAGAGG + Intergenic
957075847 3:75602796-75602818 TCCTATATTCAGAGGGAGAGAGG + Intergenic
957075861 3:75602871-75602893 CCTAATATCCACAGGGAGAGAGG + Intergenic
957077194 3:75611522-75611544 CCTAATATTCAGAGGCTGAGAGG + Intergenic
957077534 3:75613741-75613763 CCTAATATTCAGAGGCCGAGAGG + Intergenic
958016038 3:87941446-87941468 CCTTGTAGCCACAGGTAGAGAGG + Intergenic
958414302 3:93855561-93855583 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
959982197 3:112528848-112528870 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982267 3:112529240-112529262 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982281 3:112529315-112529337 CCTAATATCCAGAGGGAGAGAGG + Intergenic
960411094 3:117325636-117325658 CCTTAAAAGTGGAGGTAGAGTGG - Intergenic
961096542 3:124161460-124161482 CCTTGAAGGCAGGGGTAGAGGGG - Intronic
961278339 3:125744933-125744955 CCTAATATCCACAGGGAGAGAGG - Intergenic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
961628766 3:128281461-128281483 CTTTGTATGCAGAGGTAGCATGG + Intronic
961876055 3:130024723-130024745 CCTAATATCCACAGGGAGAGAGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963907246 3:150782785-150782807 CCTTATAAGAAGAGAAAGAGAGG + Intergenic
964888846 3:161515213-161515235 TCTAATATGCAGAGGGGGAGAGG - Intergenic
964888899 3:161515515-161515537 CCTAATATTCAGGGGAAGAGAGG - Intergenic
964888954 3:161515891-161515913 CCTAATATCCAGAGGGGGAGAGG - Intergenic
964916423 3:161847307-161847329 CCATAGATGGAGAGGTAGAGGGG + Intergenic
966505083 3:180691846-180691868 CCTTATATGCCATGTTAGAGGGG - Intronic
969019398 4:4129694-4129716 TCCTATATTCAGAGGGAGAGAGG + Intergenic
969022706 4:4148449-4148471 CCTTATATCCAGGGACAGAGAGG - Intergenic
969022843 4:4149690-4149712 CCTCATATTCAGAGGCCGAGAGG + Intergenic
969024030 4:4159572-4159594 CCTAATATCCACAGGGAGAGAGG + Intergenic
969025008 4:4166059-4166081 CCTAATATCCACAGGGAGAGAGG + Intergenic
969733246 4:8969681-8969703 CCTAATATTCAGAGGCCGAGAGG - Intergenic
969734547 4:8978249-8978271 CCTAATATCCACAGGGAGAGAGG - Intergenic
969785958 4:9457124-9457146 CCTAATATCCACAGGGAGAGAGG - Intergenic
969785973 4:9457199-9457221 TCCTATATTCAGAGGGAGAGAGG - Intergenic
969790601 4:9491659-9491681 CCTCATATTAAGAGGAAGAGAGG - Intergenic
969792835 4:9503757-9503779 CCTAATATTCAGAGGCCGAGAGG - Intergenic
969792968 4:9504912-9504934 CCTAATATCCAGGGGGAGAGAGG + Intergenic
969826115 4:9759460-9759482 CCTAATATTCAGAGGCCGAGAGG - Intergenic
970926716 4:21460607-21460629 CTTTATAAGAAGAGGAAGAGAGG - Intronic
972329379 4:38050272-38050294 CCTTACAGGCAGAGCAAGAGAGG + Intronic
972745829 4:41931943-41931965 CCTTATAAGAAGGGGAAGAGAGG + Intergenic
975245450 4:72115517-72115539 TCTTATAGGCAGAGGTGTAGTGG + Intronic
976367662 4:84247812-84247834 CCAAATATGCAGAGGTGGAAAGG - Intergenic
977884746 4:102242542-102242564 CCATAGATGGGGAGGTAGAGGGG - Intergenic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
982370433 4:154627355-154627377 CCTTTTCTCTAGAGGTAGAGAGG + Intronic
984723949 4:183002171-183002193 CCTTGTAGCCAGAGGTAAAGAGG - Intergenic
986396455 5:7335588-7335610 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
987435229 5:17885617-17885639 CCTTTTAGGCACAGGTGGAGTGG - Intergenic
987820607 5:22961515-22961537 CCTTATAAGAAGAGGAGGAGAGG - Intergenic
988130765 5:27101871-27101893 CATTATAACTAGAGGTAGAGTGG + Intronic
988443934 5:31263581-31263603 CTTTATAAGAAGAGGAAGAGAGG - Intronic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
992049949 5:72932763-72932785 CCATAGATGGGGAGGTAGAGGGG - Intergenic
994231169 5:97311821-97311843 CCATAGATGGGGAGGTAGAGGGG + Intergenic
994393564 5:99210844-99210866 CCTAATATCCAGGGGTGGAGAGG - Intergenic
994394011 5:99213690-99213712 CCTAATATGCAGGGGAAGAGAGG - Intergenic
994394751 5:99218544-99218566 CCTAATATCCAGAAGTGGAGAGG - Intergenic
994394772 5:99218696-99218718 CCTAATATCCAGGGGAAGAGAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
994395996 5:99226223-99226245 CCTAATAAGCAGAAGTGGAGAGG - Intergenic
994396216 5:99227647-99227669 CCTAATAAGCAGAAGTGGAGAGG - Intergenic
994396282 5:99228105-99228127 CCTAATATCCAGAGGGTGAGAGG - Intergenic
994557788 5:101326544-101326566 AATTATATTCAGAGGTAGAAAGG - Intergenic
994815375 5:104580021-104580043 GCTTCCATGCAGAGGTTGAGTGG + Intergenic
995706996 5:114996847-114996869 CCATAGATGGGGAGGTAGAGGGG - Intergenic
997072871 5:130639433-130639455 CCATAGATGGGGAGGTAGAGGGG - Intergenic
997684150 5:135777025-135777047 CCTAATATCCAGGGGAAGAGAGG + Intergenic
997687733 5:135800469-135800491 CCTAATATGCAGGGGAAGAGAGG + Intergenic
998112035 5:139509786-139509808 CCATAGATGGGGAGGTAGAGAGG - Intergenic
998143949 5:139715462-139715484 CCTTATAAGCAGGGGTAGTTTGG - Intergenic
998713296 5:144850414-144850436 CCATAGATGGGGAGGTAGAGGGG + Intergenic
998935882 5:147231345-147231367 CCTAATATCCAGGGGAAGAGAGG + Intergenic
999477667 5:151915985-151916007 CCTTTTATCCATTGGTAGAGGGG + Intronic
999874590 5:155788757-155788779 CTTTATTTGCAGAGGCAGATAGG + Intergenic
1001295655 5:170496985-170497007 CCTCAGCAGCAGAGGTAGAGAGG + Intronic
1002870975 6:1167018-1167040 CCTTGTGTGCAGGGGAAGAGCGG + Intergenic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1005143629 6:22662818-22662840 CCATATGTGGAGAGGAAGAGAGG + Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006287164 6:33105420-33105442 CCTTGTATGCATGGGTAGATGGG + Intergenic
1009046517 6:58242171-58242193 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009222172 6:60995503-60995525 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1009222301 6:60996258-60996280 CCTAATATCCAGGGGTGGAGAGG + Intergenic
1009222332 6:60996487-60996509 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG + Intergenic
1009226478 6:61024516-61024538 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1009226511 6:61024812-61024834 CCTAATATCCAGAGGTGGGGAGG + Intergenic
1009227369 6:61031661-61031683 CCTAATATGCAGGGGAGGAGAGG - Intergenic
1009365511 6:62854792-62854814 CCTAATATCCAGACGGAGAGAGG + Intergenic
1009365580 6:62855398-62855420 TCTAATATCCAGAGGAAGAGAGG + Intergenic
1009368587 6:62875187-62875209 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1009369104 6:62879158-62879180 TCTAATATGCAGTGGAAGAGAGG + Intergenic
1009369199 6:62879850-62879872 CCTAATATTCAGAGGGAAAGAGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012774120 6:103480795-103480817 CCTTATATCCAGGTGGAGAGAGG - Intergenic
1012775244 6:103488245-103488267 CCTAATATCCAGGGGTGGAGAGG + Intergenic
1013130121 6:107224568-107224590 CTGTATATGCAGAGGTAGTCAGG - Intronic
1013907279 6:115234697-115234719 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1014125329 6:117770324-117770346 CTTTATATGGAGAGAGAGAGAGG - Intergenic
1014209902 6:118697453-118697475 CCTAGTATGCAGAGCTTGAGTGG - Intronic
1015085205 6:129282518-129282540 CCTTATATGCAAGGGTAGAGGGG + Intronic
1015201604 6:130587714-130587736 CGATATATGCAGAGGTAAAAAGG + Intergenic
1015367601 6:132414601-132414623 CCATAAATACAGAGGTAAAGTGG + Intergenic
1016659861 6:146565824-146565846 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
1018420663 6:163638100-163638122 CCAAATATGCAGAGGTTGCGTGG - Intergenic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020306696 7:6841186-6841208 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020311153 7:6869814-6869836 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020335441 7:7058969-7058991 CCTAATATGCAGGGGGGGAGAGG - Intergenic
1020335895 7:7062197-7062219 CCTAATATCCAAAGGTAGAGAGG + Intergenic
1021329201 7:19313981-19314003 CCTTTTTTGTAGAGTTAGAGTGG + Intergenic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1024524769 7:50338626-50338648 CCTTTTATGCAAAAGTAGAAAGG + Intronic
1026687918 7:72528271-72528293 ATTTATATGCAGAGGTGGTGAGG - Intergenic
1026723137 7:72850120-72850142 ATTTATATGCAGAGGTGGTGAGG - Intergenic
1028494679 7:91449889-91449911 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1029077836 7:97950058-97950080 CCTCATATCCAGAGGGCGAGAGG + Intergenic
1029077849 7:97950133-97950155 CCTAATATCCACAGGGAGAGAGG + Intergenic
1029079134 7:97958695-97958717 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1029301319 7:99584117-99584139 CCTAATATCCAGAGAGAGAGAGG - Intronic
1029301653 7:99586275-99586297 TCTAATATCCAGAGGGAGAGAGG - Intronic
1029301838 7:99587326-99587348 CCTTATATGTAGGGGGGGAGAGG - Intronic
1029343296 7:99961425-99961447 CCTAATATCCAGGGGCAGAGAGG + Intergenic
1029344087 7:99966201-99966223 CCTAATATCCAGGGGTGGAGAGG - Intergenic
1031297701 7:120024323-120024345 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1032353425 7:131186985-131187007 CATTGTGTGCAGAGTTAGAGAGG + Intronic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1032776263 7:135116729-135116751 CCATGTAAGCAGAGGCAGAGGGG - Intronic
1032778463 7:135141066-135141088 CCTTATAGACTGAGTTAGAGAGG + Intronic
1034252546 7:149703869-149703891 CCTTATAGGAAGAGGAGGAGCGG - Intergenic
1035542542 8:453094-453116 CCTTCTGTGCTGAGGCAGAGAGG - Intronic
1036238939 8:7066877-7066899 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1036240105 8:7074144-7074166 CCTCATATCCAGGGGAAGAGAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1036530892 8:9585772-9585794 TCTTATATGCAGAGACTGAGGGG + Intronic
1036817659 8:11913947-11913969 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1036817859 8:11915073-11915095 CCTAATATCCAAAGGTGGAGAGG - Intergenic
1036819842 8:11931760-11931782 TCTTATATTCAGAAGGAGAGAGG + Intergenic
1036819856 8:11931835-11931857 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036833018 8:12036711-12036733 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1036903169 8:12687132-12687154 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1036903184 8:12687207-12687229 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036905667 8:12706796-12706818 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1036905721 8:12707100-12707122 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1036906672 8:12713218-12713240 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1038586607 8:28795339-28795361 CCTCATAAGAAGAGGAAGAGAGG + Intronic
1039692625 8:39879012-39879034 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1039999129 8:42561689-42561711 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1040796284 8:51292809-51292831 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1041750947 8:61260520-61260542 CCTGGTATGGAGAGGTGGAGAGG - Intronic
1043794656 8:84521178-84521200 CCTTATAAGAAGTGGAAGAGAGG + Intronic
1044500754 8:92952760-92952782 CCTTCTATCCAGAGGGAAAGGGG - Intronic
1045924850 8:107571729-107571751 CCTTATAACCAGGGGGAGAGAGG + Intergenic
1045924880 8:107571878-107571900 CCTTATATCCAGTGGGGGAGTGG + Intergenic
1045926235 8:107580975-107580997 CCTAATATACAGAGGGAGAGAGG + Intergenic
1045926326 8:107581664-107581686 CCTAATATCCAGAGGAAAAGAGG + Intergenic
1045926829 8:107585044-107585066 CCTAATATTCAGGGGAAGAGAGG - Intergenic
1045928799 8:107600299-107600321 CTATAGATGGAGAGGTAGAGGGG + Intergenic
1049894983 9:104563-104585 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1049895201 9:106176-106198 CCTCATATCCAGGGGAAGAGAGG + Intergenic
1049963352 9:756984-757006 CCTCATTTGCTGAGGTTGAGAGG + Intergenic
1050902494 9:10965027-10965049 CCTAATATGCAGTGGGAGAGAGG - Intergenic
1050902517 9:10965178-10965200 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1052430950 9:28365848-28365870 CCTTAGAGGCAGAGGCAGAGTGG + Intronic
1053737389 9:41109703-41109725 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1053737665 9:41111722-41111744 CCTTATATAGAGAGGGGGAGGGG + Intergenic
1053737700 9:41111915-41111937 CCTCATATCCAGGGGAAGAGAGG + Intergenic
1053737888 9:41113188-41113210 CCGTATATGCGGAGGTGCAGAGG + Intergenic
1053738059 9:41114068-41114090 CCTAATATTCAGAGGCAGAGAGG - Intergenic
1053738369 9:41116276-41116298 CCTTATGTCCAGGGGAAGAGAGG + Intergenic
1054689981 9:68315039-68315061 CCTTATATCCAGGGGAAGAGAGG - Intergenic
1054690288 9:68317251-68317273 CCTAATATTCAGAGGCAGAGAGG + Intergenic
1054690461 9:68318132-68318154 CCGTATATGCGGAGGTGCAGAGG - Intergenic
1054690649 9:68319404-68319426 CCTCATATCCAGGGGAAGAGAGG - Intergenic
1054690684 9:68319597-68319619 CCTTATATAGAGAGGGGGAGGGG - Intergenic
1054690960 9:68321616-68321638 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1056864878 9:90220383-90220405 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1056864989 9:90221456-90221478 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1056865272 9:90222983-90223005 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1056866173 9:90228866-90228888 CCTAATATCCACAGGGAGAGAGG - Intergenic
1056866187 9:90228941-90228963 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1056916840 9:90753968-90753990 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1056916853 9:90754043-90754065 CCTAATATCCACAGGAAGAGAGG + Intergenic
1058520106 9:105808265-105808287 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1058520584 9:105811258-105811280 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1058520598 9:105811343-105811365 CCTAATATCCAAAGGTAAAGAGG + Intergenic
1058521083 9:105814752-105814774 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1058521236 9:105815772-105815794 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058521542 9:105817969-105817991 CCTTATATCGAGAGGGGGAGAGG + Intergenic
1058522037 9:105821077-105821099 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1061040944 9:128140030-128140052 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1061956186 9:133962403-133962425 CTTTCTATCCAGAGGCAGAGGGG + Intronic
1203742095 Un_GL000218v1:11947-11969 CCTAATATCCAGGGGAAGAGTGG - Intergenic
1187842318 X:23501570-23501592 TTTTATATGTAAAGGTAGAGGGG - Intergenic
1188150232 X:26665218-26665240 TGTTAAATGTAGAGGTAGAGAGG - Intergenic
1190139889 X:47833550-47833572 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1193986637 X:88250964-88250986 TCTTACATGCCGAGGGAGAGTGG - Intergenic
1194812038 X:98398919-98398941 CCCTATAAGAAGAGGAAGAGAGG + Intergenic
1195552201 X:106183152-106183174 CCATAGATGGGGAGGTAGAGGGG + Intronic
1196866329 X:120074404-120074426 CCTTATTTGCTGAGTGAGAGTGG + Intronic
1196876769 X:120161877-120161899 CCTTATTTGCTGAGTGAGAGTGG - Intronic
1198286499 X:135196511-135196533 CCTTATATGAAGAGGGATATTGG - Intergenic
1199334147 X:146599272-146599294 CCTTATAGGCCCAGATAGAGAGG - Intergenic
1199464114 X:148116578-148116600 AGTTATATGCAGTGGTAGTGGGG - Intergenic
1200903349 Y:8455944-8455966 CCTTATAAAAAGAGTTAGAGAGG + Intergenic
1201155625 Y:11129423-11129445 CCTAATATCCAGGGGAAGAGTGG - Intergenic
1201404277 Y:13634346-13634368 CCATAGATGGTGAGGTAGAGGGG - Intergenic
1201407052 Y:13659989-13660011 CCATAGATGGGGAGGTAGAGGGG + Intergenic
1201455642 Y:14164712-14164734 CCATAGATGGGGAGGTAGAGGGG - Intergenic