ID: 980099841

View in Genome Browser
Species Human (GRCh38)
Location 4:128530719-128530741
Sequence CCCCATGAAAAAGGGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980099841_980099846 21 Left 980099841 4:128530719-128530741 CCTTTGTCCCCTTTTTCATGGGG No data
Right 980099846 4:128530763-128530785 TTTAAGTTCTTTGTAGATTCTGG 0: 2800
1: 6026
2: 15028
3: 8398
4: 7904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980099841 Original CRISPR CCCCATGAAAAAGGGGACAA AGG (reversed) Intergenic
No off target data available for this crispr