ID: 980102180

View in Genome Browser
Species Human (GRCh38)
Location 4:128552730-128552752
Sequence GATCGCATCCTTATGCCTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980102176_980102180 5 Left 980102176 4:128552702-128552724 CCTGCTTGGGCCCACAGGTGCCT 0: 1
1: 0
2: 0
3: 26
4: 233
Right 980102180 4:128552730-128552752 GATCGCATCCTTATGCCTAGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
980102178_980102180 -6 Left 980102178 4:128552713-128552735 CCACAGGTGCCTACAGTGATCGC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 980102180 4:128552730-128552752 GATCGCATCCTTATGCCTAGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
980102177_980102180 -5 Left 980102177 4:128552712-128552734 CCCACAGGTGCCTACAGTGATCG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 980102180 4:128552730-128552752 GATCGCATCCTTATGCCTAGCGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980102180 Original CRISPR GATCGCATCCTTATGCCTAG CGG Intergenic
921654676 1:217720776-217720798 GTTCTCTTCCTTAGGCCTAGAGG - Intronic
1073285359 10:102384222-102384244 GAGTGCATCCTTGTGCCCAGAGG + Intergenic
1090500346 11:127254895-127254917 GATCACATCATTATGCCTCATGG - Intergenic
1090662726 11:128893222-128893244 GATGGCACCATTCTGCCTAGAGG + Intronic
1101694085 12:107108060-107108082 GCTCCCATCCTTAGGCCTGGAGG - Intergenic
1102687517 12:114736135-114736157 GATCTCATCCTTCTTCCAAGTGG + Intergenic
1107342307 13:39421041-39421063 GAAGGCATTCTTATTCCTAGTGG + Intronic
1130349404 15:83078069-83078091 AATCGCAGCCTTATGAATAGAGG - Intergenic
1132506093 16:309840-309862 GATCACACGCTTACGCCTAGAGG + Intronic
1141309566 16:82900176-82900198 GATCACATCTTTATTCCTGGTGG + Intronic
1155465390 18:26129122-26129144 GAATGCCTCCTTATTCCTAGAGG + Intergenic
1158089606 18:53695027-53695049 GAATGCATCCTTATCCTTAGAGG - Intergenic
925238432 2:2299304-2299326 GATCTCCTCCTGGTGCCTAGCGG + Intronic
931947319 2:67324679-67324701 GAACGCATCCTTCTGCCACGGGG - Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1181295767 22:21837403-21837425 GATCTCATCCAAATTCCTAGGGG - Intronic
949210387 3:1491879-1491901 GAACACATCCACATGCCTAGAGG - Intergenic
958455155 3:94321789-94321811 GAATGCCTCCTTATGCCTAGAGG - Intergenic
970191443 4:13522888-13522910 TTTCGCATCCTTAAGCCTCGTGG - Intergenic
971119242 4:23685743-23685765 AATCGCATCCTTATTCTTAAAGG - Intergenic
972837213 4:42886925-42886947 GATCGCATCCTTTTGCTTCCAGG + Intergenic
975516057 4:75249631-75249653 GATTGCATCCTTTTGCCTGATGG + Intergenic
979458863 4:120957202-120957224 AATTGCTTCCTAATGCCTAGAGG - Intergenic
980102180 4:128552730-128552752 GATCGCATCCTTATGCCTAGCGG + Intergenic
983412505 4:167418337-167418359 AGGAGCATCCTTATGCCTAGTGG + Intergenic
992789904 5:80204019-80204041 GAACGCATCCATGTGCCTGGAGG + Intronic
995903881 5:117100467-117100489 TATAGCATCCTTATCCATAGTGG - Intergenic
1002988968 6:2220183-2220205 GAACGCCTCCTTATCCCTAGAGG + Intronic
1014093758 6:117436701-117436723 TATCTCATCTTTATGCCTTGGGG + Intronic
1014896842 6:126911595-126911617 GATAGGATCCTTTTACCTAGAGG - Intergenic
1031947244 7:127855064-127855086 CATCTCAACCTTATGCCGAGTGG - Intronic
1039833661 8:41237621-41237643 GAGGGCATCCTTATGCTCAGTGG + Intergenic
1044358672 8:91256388-91256410 ACTCATATCCTTATGCCTAGAGG - Intronic
1047422478 8:124718507-124718529 GATCACATCCTGCTGCCGAGCGG + Intronic
1048846946 8:138611133-138611155 GATCGCTGCCCTATGCCAAGAGG + Intronic
1200448489 Y:3294773-3294795 GATGGCATGCTTATGACCAGAGG + Intergenic