ID: 980102227

View in Genome Browser
Species Human (GRCh38)
Location 4:128553181-128553203
Sequence CCCCGGGAGGAGAGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980102227_980102237 4 Left 980102227 4:128553181-128553203 CCTCCGGAGCTCTCCTCCCGGGG No data
Right 980102237 4:128553208-128553230 GAGCAGCTCCTCTCGTGGTGCGG No data
980102227_980102236 -1 Left 980102227 4:128553181-128553203 CCTCCGGAGCTCTCCTCCCGGGG No data
Right 980102236 4:128553203-128553225 GGGGAGAGCAGCTCCTCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980102227 Original CRISPR CCCCGGGAGGAGAGCTCCGG AGG (reversed) Intergenic