ID: 980104356

View in Genome Browser
Species Human (GRCh38)
Location 4:128573448-128573470
Sequence GTGAGCAAAACAAAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980104355_980104356 17 Left 980104355 4:128573408-128573430 CCAAATTAGTTCACTGAATTGAG No data
Right 980104356 4:128573448-128573470 GTGAGCAAAACAAAAGCTGCTGG No data
980104354_980104356 25 Left 980104354 4:128573400-128573422 CCATACAACCAAATTAGTTCACT No data
Right 980104356 4:128573448-128573470 GTGAGCAAAACAAAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980104356 Original CRISPR GTGAGCAAAACAAAAGCTGC TGG Intergenic
No off target data available for this crispr