ID: 980105542

View in Genome Browser
Species Human (GRCh38)
Location 4:128584848-128584870
Sequence TTGGAGAATTAGACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980105539_980105542 9 Left 980105539 4:128584816-128584838 CCTTTTAGCTGGGGCTTCTTAAA No data
Right 980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG No data
980105534_980105542 25 Left 980105534 4:128584800-128584822 CCCACTGTGCTGTTTGCCTTTTA No data
Right 980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG No data
980105535_980105542 24 Left 980105535 4:128584801-128584823 CCACTGTGCTGTTTGCCTTTTAG No data
Right 980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980105542 Original CRISPR TTGGAGAATTAGACTGAGGA TGG Intergenic
No off target data available for this crispr