ID: 980112848

View in Genome Browser
Species Human (GRCh38)
Location 4:128651034-128651056
Sequence GACATGACATGCCCCTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980112845_980112848 6 Left 980112845 4:128651005-128651027 CCAAAATACCACCAATAATGAGA No data
Right 980112848 4:128651034-128651056 GACATGACATGCCCCTGTTATGG No data
980112843_980112848 18 Left 980112843 4:128650993-128651015 CCTAGCTGTTACCCAAAATACCA No data
Right 980112848 4:128651034-128651056 GACATGACATGCCCCTGTTATGG No data
980112847_980112848 -5 Left 980112847 4:128651016-128651038 CCAATAATGAGACAAAGTGACAT No data
Right 980112848 4:128651034-128651056 GACATGACATGCCCCTGTTATGG No data
980112844_980112848 7 Left 980112844 4:128651004-128651026 CCCAAAATACCACCAATAATGAG No data
Right 980112848 4:128651034-128651056 GACATGACATGCCCCTGTTATGG No data
980112846_980112848 -2 Left 980112846 4:128651013-128651035 CCACCAATAATGAGACAAAGTGA No data
Right 980112848 4:128651034-128651056 GACATGACATGCCCCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980112848 Original CRISPR GACATGACATGCCCCTGTTA TGG Intergenic