ID: 980119985

View in Genome Browser
Species Human (GRCh38)
Location 4:128717860-128717882
Sequence GGCAAATGGCCCTCTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980119980_980119985 12 Left 980119980 4:128717825-128717847 CCTGAAAATCAATTTATTTGAAA No data
Right 980119985 4:128717860-128717882 GGCAAATGGCCCTCTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980119985 Original CRISPR GGCAAATGGCCCTCTTCTCA GGG Intergenic
No off target data available for this crispr