ID: 980129697

View in Genome Browser
Species Human (GRCh38)
Location 4:128807160-128807182
Sequence GAGTCATATTGGGAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980129686_980129697 27 Left 980129686 4:128807110-128807132 CCTTAGGCATTATTTTTCCTATC No data
Right 980129697 4:128807160-128807182 GAGTCATATTGGGAGTTGGTGGG No data
980129690_980129697 10 Left 980129690 4:128807127-128807149 CCTATCATCTCAGTGGGGAAACT No data
Right 980129697 4:128807160-128807182 GAGTCATATTGGGAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980129697 Original CRISPR GAGTCATATTGGGAGTTGGT GGG Intergenic
No off target data available for this crispr