ID: 980130035

View in Genome Browser
Species Human (GRCh38)
Location 4:128809865-128809887
Sequence GCGCGCGTACCTGCTGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980130035_980130047 -1 Left 980130035 4:128809865-128809887 CCCTCCGCAGCAGGTACGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 980130047 4:128809887-128809909 CGGGCCGCGGGGGGCGCGCGGGG 0: 1
1: 1
2: 15
3: 167
4: 906
980130035_980130044 -10 Left 980130035 4:128809865-128809887 CCCTCCGCAGCAGGTACGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 980130044 4:128809878-128809900 GTACGCGCGCGGGCCGCGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 146
980130035_980130046 -2 Left 980130035 4:128809865-128809887 CCCTCCGCAGCAGGTACGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 980130046 4:128809886-128809908 GCGGGCCGCGGGGGGCGCGCGGG 0: 1
1: 0
2: 17
3: 157
4: 1018
980130035_980130045 -3 Left 980130035 4:128809865-128809887 CCCTCCGCAGCAGGTACGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 980130045 4:128809885-128809907 CGCGGGCCGCGGGGGGCGCGCGG 0: 1
1: 5
2: 38
3: 163
4: 1110
980130035_980130050 3 Left 980130035 4:128809865-128809887 CCCTCCGCAGCAGGTACGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 980130050 4:128809891-128809913 CCGCGGGGGGCGCGCGGGGTGGG 0: 1
1: 1
2: 8
3: 66
4: 514
980130035_980130048 2 Left 980130035 4:128809865-128809887 CCCTCCGCAGCAGGTACGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 980130048 4:128809890-128809912 GCCGCGGGGGGCGCGCGGGGTGG 0: 1
1: 2
2: 14
3: 163
4: 1169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980130035 Original CRISPR GCGCGCGTACCTGCTGCGGA GGG (reversed) Exonic
901875980 1:12167308-12167330 GCGCGCGTGTCTGATGCGGATGG - Intronic
918205155 1:182301787-182301809 GCGCGCGTGCATGCTGGTGAGGG - Intergenic
1074065452 10:110008517-110008539 GGGAGCGTACCTGCGGGGGAGGG + Intronic
1076691658 10:132226754-132226776 GCGCAGGTACCTGCTGAGGTGGG - Intronic
1077948290 11:6926496-6926518 GCACGCGCACCAGCTGTGGAAGG - Exonic
1089640936 11:119846811-119846833 CCTCGCTTTCCTGCTGCGGAGGG - Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1103392067 12:120581549-120581571 GCGCGCATGCGTCCTGCGGAGGG + Intergenic
1122275033 14:100586946-100586968 ACGCGCGCCCCTGCGGCGGAAGG - Intronic
1132505170 16:304420-304442 GCGCACGTACCGGGTGCCGAAGG - Exonic
1132689940 16:1177923-1177945 GCCCGGGCACCTGCTGGGGACGG - Intronic
1133035045 16:3029727-3029749 GTGCGCGTTCCAGCTGTGGACGG + Exonic
1135561384 16:23479447-23479469 GAGCACATACCTGCTGCTGAGGG - Intronic
1141578594 16:84981860-84981882 GCGCACGTACCTGCAGTGGTGGG + Exonic
1151678675 17:75613027-75613049 GGGCGCATACCTGGTGCGGCAGG + Intergenic
1152680728 17:81666562-81666584 GCGGGCGATGCTGCTGCGGAGGG - Exonic
1161232151 19:3179715-3179737 GCACACCTCCCTGCTGCGGAAGG - Exonic
1161699160 19:5785502-5785524 GGGCACGTACCTGCGGCGGGTGG + Exonic
1166151789 19:40880396-40880418 GCGCGCGTTCTGCCTGCGGATGG - Intronic
933762117 2:85679529-85679551 GCCCACGCACCTGCTGAGGAAGG + Intergenic
940306911 2:152236818-152236840 GAGAGCCTACCTGCTGTGGAAGG - Intergenic
1174869878 20:54172970-54172992 GAGCGCGTACCCGCAGCGGCTGG - Exonic
1179504019 21:41828135-41828157 GCCTGCGCACCTGCTGCGGGCGG - Intronic
1179724631 21:43335319-43335341 GGGTGCGTGCCTGCTGCTGACGG - Intergenic
1182429014 22:30289375-30289397 GGGCGCGCACCGGCTGCGGCGGG + Exonic
1203252529 22_KI270733v1_random:124860-124882 GCGTGCGTCCCGGCTGCGGTCGG + Intergenic
953694420 3:45146420-45146442 GCTCGCGATCCTGCTGCGCAGGG - Exonic
964674492 3:159262563-159262585 GCGAGAGTACCTGCAGCGGCAGG + Exonic
969657009 4:8504336-8504358 GCGCGGGTACCTGGCGGGGAAGG - Intergenic
980130035 4:128809865-128809887 GCGCGCGTACCTGCTGCGGAGGG - Exonic
1007927805 6:45663789-45663811 GCGCGCTTCGCTGCTGGGGAGGG - Intronic
1018907947 6:168086098-168086120 GCTGGCGTCCCTGCTGGGGATGG - Intergenic
1020014929 7:4825280-4825302 GCGCGGGTATCTCCTGCGGGTGG + Intronic
1022048217 7:26640315-26640337 GCCCGTGTGCCTGCTGTGGATGG - Intronic
1026736972 7:72954885-72954907 GCGGGCGCACCTGCTGGGGTAGG + Intergenic
1027106760 7:75410178-75410200 GCGGGCGCACCTGCTGGGGTAGG - Intronic
1027126169 7:75558166-75558188 CCACGCTGACCTGCTGCGGAAGG - Exonic
1029285894 7:99465931-99465953 GCGCGCCTTCCTGCTGCCCAGGG - Intronic
1031400849 7:121325109-121325131 GCGCGCGCACATGGTGGGGAGGG - Intergenic
1032195266 7:129785013-129785035 GCGCGGGTCCCTGCTGGGTAGGG - Intergenic
1034421082 7:150991288-150991310 GAGCAGGTACCTGCTGCAGAAGG - Exonic
1034673787 7:152876955-152876977 GCCCGCGTGCCTGCAGCGGAAGG - Intergenic
1038939308 8:32286317-32286339 GGGCTCTTTCCTGCTGCGGAAGG + Intronic
1039434361 8:37549428-37549450 GCCCGCGTCACTGCTGCGGCAGG + Intergenic
1045047692 8:98294470-98294492 GCGCGGGGACCCGTTGCGGACGG - Intergenic
1045738243 8:105319857-105319879 GCGAGCGTGCCTGTTTCGGAAGG - Intronic
1053131276 9:35617112-35617134 GCGCCTGTCCCGGCTGCGGATGG - Intronic
1053153388 9:35756959-35756981 GCATGCGTGCCTGCTGGGGAGGG + Exonic
1057228679 9:93305794-93305816 GAGCGTGTTCCTGCTGCGGAGGG + Intronic
1057453892 9:95190281-95190303 ACGCGGGTCACTGCTGCGGAGGG - Intronic
1062160123 9:135075373-135075395 GCGCGCGTTCGTGCTCCGCAGGG + Intergenic
1062305789 9:135906778-135906800 GTGGGCGTCCCTGCGGCGGAGGG - Intronic
1062413904 9:136438613-136438635 GCGGACGTCCTTGCTGCGGATGG + Exonic
1200281319 X:154779294-154779316 GTGAGCGTACTGGCTGCGGATGG + Exonic