ID: 980130527

View in Genome Browser
Species Human (GRCh38)
Location 4:128812167-128812189
Sequence GGACGCCGCTGCGGAGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980130513_980130527 25 Left 980130513 4:128812119-128812141 CCGCGGCGGGGGGTGGCCACTTT 0: 1
1: 0
2: 0
3: 0
4: 55
Right 980130527 4:128812167-128812189 GGACGCCGCTGCGGAGGGAGCGG 0: 1
1: 0
2: 1
3: 29
4: 258
980130517_980130527 9 Left 980130517 4:128812135-128812157 CCACTTTCAAATGGAGAGGGCGG 0: 1
1: 0
2: 2
3: 11
4: 70
Right 980130527 4:128812167-128812189 GGACGCCGCTGCGGAGGGAGCGG 0: 1
1: 0
2: 1
3: 29
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980130527 Original CRISPR GGACGCCGCTGCGGAGGGAG CGG Intronic
900113744 1:1020087-1020109 GGACGCAGCTCCGGAGGCGGCGG - Intergenic
900237491 1:1599766-1599788 GGACGCTGGCGCGCAGGGAGCGG + Exonic
900645414 1:3706694-3706716 GGAGGCCCCAGCTGAGGGAGGGG - Intronic
901737578 1:11322227-11322249 GGACACCTCTGCGGGGAGAGGGG - Intergenic
903986987 1:27235204-27235226 GGGAGGCTCTGCGGAGGGAGAGG + Intronic
904004700 1:27357622-27357644 AGACGCTGCCGCGGAGGTAGGGG + Intronic
905340370 1:37273789-37273811 GGTGGCTGCTGAGGAGGGAGGGG - Intergenic
905449287 1:38046647-38046669 GGACGCCGCGGCGGCGGCGGCGG - Exonic
905779067 1:40691907-40691929 GGAAGCGGCGGCGGGGGGAGGGG + Intronic
905960264 1:42036614-42036636 GGGCGCCGGTGCTGAGGGAGAGG - Intergenic
909433402 1:75615343-75615365 GGACGAAGGGGCGGAGGGAGGGG + Intergenic
911725408 1:101236957-101236979 GTGCTCCGCTGCGGAGGGAGGGG + Exonic
913219213 1:116645924-116645946 GGACGCGACTGCGCTGGGAGTGG + Intronic
913521475 1:119648616-119648638 GGAGGGCTCTGCGGTGGGAGAGG + Intergenic
915932772 1:160070230-160070252 CTCCGGCGCTGCGGAGGGAGGGG - Exonic
919678344 1:200409445-200409467 GGCCGGGGCTGCGGAGGTAGAGG + Exonic
919892102 1:201982935-201982957 CGGCGGCGCTGCGGCGGGAGCGG + Exonic
921225444 1:213015264-213015286 GGACGGTGCTGCGGAGTGTGTGG + Intronic
922809741 1:228408852-228408874 GGAGGCCTCTGCGGAGTTAGGGG - Intronic
924454853 1:244211112-244211134 GGAGGCCGCTGCGGAGGGGCTGG - Intergenic
1063117901 10:3084966-3084988 GGACCGTGCTGGGGAGGGAGTGG - Intronic
1063117911 10:3084990-3085012 GGACCGTGCTGGGGAGGGAGTGG - Intronic
1063117921 10:3085014-3085036 GGACCGTGCTGGGGAGGGAGTGG - Intronic
1063117931 10:3085038-3085060 GGACCGTGCTGGGGAGGGAGTGG - Intronic
1063117941 10:3085062-3085084 GGACCGTGCTGGGGAGGGAGTGG - Intronic
1063117951 10:3085086-3085108 GGACCGTGCTGGGGAGGGAGTGG - Intronic
1063117964 10:3085135-3085157 GGACTGTGCTGGGGAGGGAGTGG - Intronic
1063118091 10:3085526-3085548 GGACTGTGCTGGGGAGGGAGTGG - Intronic
1063118100 10:3085550-3085572 GGACTGTGCTGGGGAGGGAGTGG - Intronic
1067837488 10:49650697-49650719 GGACGCCCCTGAGGAGGCTGTGG + Intronic
1068316544 10:55351050-55351072 GGAGGCAGCAGCGGGGGGAGGGG - Intronic
1069949109 10:72007352-72007374 GGAGGCCGCAGGGGAGGAAGAGG + Exonic
1071618174 10:87094974-87094996 GGAGGCCGCGGCGGAGGCGGAGG - Intronic
1074121780 10:110498550-110498572 GGGCGCCCCGGCGCAGGGAGGGG - Intronic
1075697596 10:124448044-124448066 GGAGGCCGCGGCTGCGGGAGCGG - Exonic
1076667669 10:132102371-132102393 GGATGCCACTGCAGACGGAGGGG - Intergenic
1076722041 10:132397018-132397040 GGACGCGGCGGCGGCGGGCGGGG + Intergenic
1076731410 10:132440835-132440857 GGACGCTGCTGAGGAGACAGTGG - Intergenic
1077023409 11:429722-429744 GGACGCCTCTGCGGGGCCAGGGG - Intronic
1080418742 11:32092055-32092077 GGAGGCCGAGGCGGGGGGAGGGG + Intronic
1081699964 11:45146768-45146790 GGCGGCCCCCGCGGAGGGAGCGG - Intronic
1083639333 11:64136839-64136861 GGAGGCCCCTGTGCAGGGAGGGG - Intronic
1084028442 11:66467032-66467054 GGCCGCCGGGGCGGAGGGGGCGG + Intronic
1084516850 11:69642129-69642151 GGACGCCGCTAGGGAAGGGGGGG + Intronic
1085037361 11:73308412-73308434 GGTCGGCGCTGAGGCGGGAGGGG + Exonic
1090409969 11:126501347-126501369 AGACGGGGCTGCAGAGGGAGAGG + Intronic
1091712593 12:2752614-2752636 GGACGCCCTTGCCGAGGGCGCGG + Intergenic
1092253572 12:6914694-6914716 GGGCGCCGCGGCGAAGGGAGGGG - Intronic
1095098560 12:38160419-38160441 GGAAGCCGCTGCGCAGGGCCCGG + Intergenic
1095687242 12:45050489-45050511 GGGCGCGGCTGGGGAGGGAGGGG + Intronic
1096623425 12:52878824-52878846 GGCTGCCGCTGCAGAGGGTGGGG + Intergenic
1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG + Intronic
1102973603 12:117190381-117190403 GGAGGCCGCGCCGGAGGTAGCGG - Exonic
1103415336 12:120739057-120739079 GGCCTCCCCTGCTGAGGGAGTGG + Intronic
1103623679 12:122203817-122203839 GGACGCCGCTGCTGTGAGGGAGG + Intronic
1104008869 12:124914978-124915000 GGAGGCCGCTGCACCGGGAGCGG + Exonic
1108408054 13:50124445-50124467 GGGAGCAGCTGGGGAGGGAGCGG + Intronic
1108844484 13:54660544-54660566 AGACGCCCCTGCAGTGGGAGAGG - Intergenic
1113379404 13:109787683-109787705 GGACGCCCCTGTGGAAGGAAGGG - Intergenic
1113603274 13:111586435-111586457 GGACGCGAGCGCGGAGGGAGAGG - Intergenic
1113787307 13:113009204-113009226 TGACGCCCCTGCGGTAGGAGCGG + Intronic
1115320812 14:32077334-32077356 GGAGGCGGCGGCGGCGGGAGCGG + Exonic
1116454944 14:45109060-45109082 GGTCGCAGCTGAGGAGGTAGGGG - Intronic
1117478367 14:56118959-56118981 GGAGGACGCGGCGGAGGAAGTGG + Intronic
1121417424 14:93788779-93788801 GGCCGCCGAGGCGGAGGCAGAGG + Intergenic
1121449013 14:93996163-93996185 GGACGTGGATGCAGAGGGAGAGG - Intergenic
1121667770 14:95686021-95686043 GGAGGAGGCTGCGGAGGGACTGG + Intergenic
1121800993 14:96774091-96774113 GAACTCCGCTGCACAGGGAGGGG - Intergenic
1121916226 14:97838961-97838983 GGAGGCCATTGGGGAGGGAGGGG - Intergenic
1122347186 14:101067757-101067779 GGACCCAGCTCCGGAAGGAGGGG - Intergenic
1122444605 14:101760504-101760526 GGAAGGAGCTGCGGAGGGCGGGG + Intergenic
1122688221 14:103520013-103520035 GGACACGGCTGCGGTGGGCGGGG - Exonic
1123008462 14:105335665-105335687 GGAGGCTGCTGTGGAGTGAGAGG - Intronic
1123827886 15:24101578-24101600 GGTCGCAGCTGCGCAGTGAGGGG + Intergenic
1123842345 15:24260989-24261011 GGTCGCAGCTGCGCAGTGAGGGG + Intergenic
1123857374 15:24427048-24427070 GGTCGCAGCTGCGCAGTGAGGGG + Intergenic
1123862005 15:24477580-24477602 GGTCGCAGCTGCGCAGTGAGGGG + Intergenic
1125675855 15:41502292-41502314 GGACGGCGAGGCGGTGGGAGAGG - Intronic
1126849038 15:52786640-52786662 GGACGGCACTGTGGAGGGGGAGG - Intronic
1127794697 15:62427602-62427624 GGATGCTGCTGCGGAAGGGGAGG - Intronic
1127868219 15:63048638-63048660 GGACGCCGCTGAGGAGCGCGCGG + Intronic
1129104490 15:73296668-73296690 GGCCTCCACTGCGGGGGGAGGGG - Intronic
1130339394 15:82986382-82986404 GGACGCCCGGGAGGAGGGAGCGG + Intronic
1130912805 15:88282621-88282643 AGACGCCACTGGGGAGGGGGAGG - Intergenic
1132843504 16:1989851-1989873 GGTGGGCGCGGCGGAGGGAGAGG + Intronic
1133021096 16:2967327-2967349 GGACGCCGCTGAGGACCCAGAGG + Exonic
1134066774 16:11233358-11233380 AGACGCGGCCGCGGAGGCAGCGG - Intergenic
1134143584 16:11742664-11742686 GGACGCCGAGGACGAGGGAGGGG - Exonic
1135988748 16:27204119-27204141 GGAAGGCGCTGAGGAGGGAAGGG + Exonic
1135994381 16:27237333-27237355 GGCTGCCGCAGTGGAGGGAGAGG - Intronic
1136333197 16:29595119-29595141 GGAGGCGGCGGCGGAGGGCGGGG + Intergenic
1136414744 16:30096229-30096251 TGCCGCCGCTGCGGCGGGAGGGG + Intronic
1136447883 16:30335158-30335180 GGAGGCGGCGGCGGAGGGCGGGG + Intergenic
1137767764 16:50991230-50991252 TGCCGCCGCTGCCAAGGGAGGGG - Intergenic
1139088755 16:63618403-63618425 GGAGGGGGCTGCGGAGGCAGGGG + Intergenic
1140894231 16:79311060-79311082 GGAGGCCAGTGCTGAGGGAGTGG - Intergenic
1141531369 16:84648807-84648829 GGGCGCCGCGGCCGGGGGAGGGG + Intronic
1141959178 16:87392782-87392804 GCACCCCGCCGCGGAGGGCGCGG - Intronic
1142067672 16:88072107-88072129 GGACCCCGCGGCGGCGGGCGTGG + Exonic
1142313520 16:89328655-89328677 GGAGGCCCCTGCTGAGTGAGTGG + Intronic
1142313531 16:89328707-89328729 GGAGGCCCCTGCTGAGTGAGTGG + Intronic
1142313542 16:89328759-89328781 GGAGGCCCCTGCTGAGTGAGTGG + Intronic
1142313553 16:89328810-89328832 GGAGGCCCCTGCTGAGTGAGTGG + Intronic
1142313564 16:89328862-89328884 GGAGGCCCCTGCTGAGTGAGTGG + Intronic
1142313575 16:89328914-89328936 GGAGGCCCCTGCTGAGTGAGTGG + Intronic
1142313586 16:89328966-89328988 GGAGGCCCCTGCTGAGTGAGTGG + Intronic
1142414839 16:89935729-89935751 GGACGCCACGGCCGAGGAAGAGG + Exonic
1142836953 17:2594129-2594151 GGAGGCGGCGGCGGAGGCAGGGG - Intronic
1142863387 17:2776731-2776753 GGTGGCGGCTGCGGAGGGCGCGG + Intergenic
1143018469 17:3904212-3904234 GGAGGCCGCCTCGGCGGGAGGGG + Intronic
1143590665 17:7884683-7884705 GGACGCCGCCGCCGAGGAGGAGG + Intronic
1145037700 17:19552799-19552821 TTACGCCACTGCGGTGGGAGGGG + Intronic
1145786512 17:27597329-27597351 GGGCGCCGGTGAGGAGGGTGTGG - Exonic
1146234362 17:31144613-31144635 GGACGCCATTGTGGAGAGAGAGG - Intronic
1146762404 17:35490048-35490070 CGGCGCCGCTTTGGAGGGAGAGG - Intronic
1147993017 17:44346406-44346428 GGATACCACTGCGGGGGGAGGGG - Intronic
1148262312 17:46193824-46193846 GGCCGGCGCCGCGGAGCGAGAGG + Intronic
1149772463 17:59332170-59332192 GGACGACGCGGAGGAGGAAGCGG - Intronic
1150227997 17:63534206-63534228 GGACGGCGATGCGGCGGGGGTGG - Exonic
1151222649 17:72624457-72624479 GGAGGCAGCTGGAGAGGGAGGGG + Intergenic
1152107884 17:78341675-78341697 GTGCGGCGCTGGGGAGGGAGGGG + Intergenic
1152446857 17:80349933-80349955 GGCTGCGGCTGGGGAGGGAGAGG - Intronic
1152512464 17:80799741-80799763 GGCGGCCGCTGGGGAGGGAAGGG - Intronic
1152595655 17:81236462-81236484 GGAGGACCCAGCGGAGGGAGGGG + Intronic
1152606688 17:81295026-81295048 GGACGCCGGTGGGGAGGGGATGG + Exonic
1152658055 17:81529104-81529126 GGCCGTCGCTGCGCAGGTAGCGG - Exonic
1152683651 17:81683316-81683338 GGAAGCCGTTGCGAGGGGAGAGG + Intronic
1152818871 17:82425428-82425450 GGAGGCCTCCGCGCAGGGAGGGG + Intronic
1153815279 18:8785441-8785463 TGCCGCCGCTGGGGAGGGCGCGG + Intronic
1154097638 18:11432667-11432689 GCAGGCAGGTGCGGAGGGAGAGG - Intergenic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155428989 18:25735880-25735902 AGACCCCACTGCGGAGGGTGAGG - Intergenic
1159072191 18:63637868-63637890 GGAGGTCACTGAGGAGGGAGTGG - Exonic
1160454665 18:78992330-78992352 GGAGGCGGGTGCGGAGGGCGCGG + Exonic
1160499167 18:79394065-79394087 GGAGGCGGCAGCGGAGGAAGGGG + Intergenic
1161007049 19:1941989-1942011 GGACACAGCTGCGTGGGGAGGGG - Intronic
1161009566 19:1953770-1953792 GGACCCTGATGCGGGGGGAGGGG - Intronic
1161428606 19:4217794-4217816 GGACGCCGCTGAGGCCCGAGTGG + Exonic
1161692545 19:5745184-5745206 GGCCGCGGCGGCGGAGGGTGGGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162485920 19:10960681-10960703 GGACGCCACTGCGGCGGCGGTGG - Intergenic
1162746551 19:12801852-12801874 GCACGGCGCGGGGGAGGGAGCGG + Exonic
1162960105 19:14120545-14120567 GGAGGCCGCAGCCCAGGGAGGGG + Exonic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163674733 19:18649902-18649924 GCACTCCGCTGCGCAGTGAGGGG - Intronic
1165845058 19:38812799-38812821 GGACGGAGCTGCGGGCGGAGTGG + Intronic
1165904208 19:39183732-39183754 GGCTGCCACTGGGGAGGGAGAGG + Intergenic
1166948957 19:46413677-46413699 GGAGGCCGCCCCGAAGGGAGTGG - Intergenic
1167743619 19:51338945-51338967 GGACGCCGCTGAGCCGGGGGTGG + Exonic
1168241941 19:55092858-55092880 GGGCGCCTCTGCTGGGGGAGGGG + Exonic
1168468987 19:56625704-56625726 AGAGGCCCCTGCGGTGGGAGTGG - Exonic
1168719056 19:58544882-58544904 CGACGCCGCGGCTGAGGCAGAGG - Exonic
925066327 2:931718-931740 GGGGGCCATTGCGGAGGGAGAGG + Intergenic
926111873 2:10188810-10188832 AGAGGGCGCTGCGGAGAGAGTGG + Intronic
927652483 2:24920600-24920622 GGAAGCCGCGGCGGAGGAGGGGG - Intergenic
927707217 2:25303797-25303819 GGTTCCCTCTGCGGAGGGAGGGG + Intronic
928093925 2:28392721-28392743 GGAGGCCGCGGAGGAGGAAGAGG - Intronic
928669397 2:33585311-33585333 GGAGGCCGAGGAGGAGGGAGAGG - Exonic
929821901 2:45280921-45280943 GGATGCCGGGGAGGAGGGAGCGG - Intergenic
932481394 2:72041675-72041697 GGAAGCAGCTGGGGAGGGAGGGG - Intergenic
932611515 2:73203261-73203283 GCACGCTGCTGAGGTGGGAGAGG + Intronic
934257876 2:91442945-91442967 GAAAGCGGCTGCGGGGGGAGGGG - Intergenic
934477219 2:94601780-94601802 GGAGGCCTCTGCAGAGGGAGAGG + Intronic
934688085 2:96335985-96336007 AGAGGCCGGTGCGGGGGGAGGGG + Intronic
947506561 2:230712666-230712688 GGAAGCTGCGGCGGAGGAAGAGG + Intergenic
948151511 2:235748256-235748278 GCATGCCGCTGAGGACGGAGGGG + Intronic
948393324 2:237627545-237627567 TGACGCCGCGGCGGAGGGAGGGG + Intergenic
948415324 2:237798790-237798812 GGAGGCGGCTGCGGAGAGCGGGG + Exonic
948424209 2:237877389-237877411 GGACACGGTTGGGGAGGGAGAGG + Intronic
948663546 2:239521003-239521025 GGACGCGTCTTCGGAGGGTGGGG + Intergenic
948936302 2:241167090-241167112 GGAGGCAGCTGAGGAGGGTGGGG - Intronic
1168845428 20:941249-941271 GGATGAGGCTGCAGAGGGAGTGG + Intergenic
1171120908 20:22568346-22568368 CGACCCCGCTGCGGTGGGAGCGG - Intergenic
1172786535 20:37472399-37472421 GGTGGCCTCTGGGGAGGGAGGGG + Intergenic
1172896342 20:38302926-38302948 TGAGGCTGCTGCAGAGGGAGGGG + Intronic
1173822915 20:46030399-46030421 GGAAGCCGCGGAGGAGGGCGGGG - Intronic
1173839285 20:46146726-46146748 GGAGGCTGCTGGGGAGAGAGGGG - Intergenic
1176546632 21:8205154-8205176 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176554526 21:8249345-8249367 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176565583 21:8388201-8388223 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176573448 21:8432369-8432391 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1178696039 21:34793137-34793159 GGATGCTGCTGCCTAGGGAGAGG + Intronic
1179272966 21:39865774-39865796 GGAGGCCCCTGGGGAGGGTGTGG + Intergenic
1179613564 21:42567356-42567378 GGACGCCTCTGCAGAGAGAGAGG + Intronic
1179674842 21:42974452-42974474 GCCCGCCGCCGCGCAGGGAGGGG + Intergenic
1180820506 22:18823980-18824002 GGACGCGACTGCGCTGGGAGTGG + Intergenic
1180939045 22:19644938-19644960 AGACACCCCTGGGGAGGGAGAGG - Intergenic
1180950601 22:19718927-19718949 CGAGGCCGCTGCGGAGGGAAGGG - Intronic
1180987479 22:19913353-19913375 GGCTGCCGCTGAGGTGGGAGTGG - Intronic
1181206730 22:21258452-21258474 GGACGCGACTGCGCTGGGAGTGG + Intergenic
1181422313 22:22810578-22810600 GGACACTGCTGGAGAGGGAGGGG - Intronic
1183102935 22:35594912-35594934 GGATGCCGCTGGGGAGGGCTGGG - Intergenic
1183951894 22:41357059-41357081 GGACCCAGCTGCCCAGGGAGAGG + Intronic
1184276387 22:43411725-43411747 GCATCCCGCTGCGGAGGGACAGG - Intronic
1184891009 22:47379201-47379223 GGACGCGGCGGAGGAGGCAGAGG + Intergenic
1185002024 22:48252024-48252046 GGACGCAGCTGCTGATGGAGCGG - Intergenic
1185002094 22:48252376-48252398 GGACGCAGCTGCTGATGGAGCGG - Intergenic
1185002172 22:48252769-48252791 GGACGCAGCTGCTGATGGAGCGG - Intergenic
1185002269 22:48253257-48253279 GGACGCGGCTGCTGATGGAGCGG - Intergenic
1203220194 22_KI270731v1_random:36971-36993 GGACGCGACTGCGCTGGGAGTGG - Intergenic
1203251497 22_KI270733v1_random:121420-121442 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1203259547 22_KI270733v1_random:166502-166524 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1203270632 22_KI270734v1_random:49855-49877 GGACGCGACTGCGCTGGGAGTGG + Intergenic
949265960 3:2156402-2156424 GGACGCTGCTGAGGAAGGCGCGG - Intronic
949970248 3:9397678-9397700 CGCCGCCGCTGCCGGGGGAGGGG + Intronic
950215224 3:11154316-11154338 GGCCGCCCCCGCGGAGAGAGGGG - Intronic
954779117 3:53046185-53046207 GGATGGCGCTGGGGCGGGAGCGG - Intronic
956784464 3:72630842-72630864 GGATGCTTCTGCAGAGGGAGAGG - Intergenic
959497225 3:107065496-107065518 GGGCCCTGCTGCCGAGGGAGGGG - Intergenic
965596748 3:170418686-170418708 GGACTGCGCTGCGGACGGGGTGG + Intergenic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
968502221 4:956090-956112 GGGAGCCGCTGGGAAGGGAGGGG - Intronic
968603329 4:1520608-1520630 GGTCGCCGCCGCGTAGGGAGGGG - Intergenic
968730720 4:2268067-2268089 GAAGGCTGCTGCGGAGGCAGGGG - Intergenic
968965277 4:3766333-3766355 CGACGCGGCTGCGGGGGGAGGGG - Intronic
969113369 4:4857072-4857094 GGACTCCGCCGCGGGGGGGGGGG - Intergenic
970593995 4:17583547-17583569 TCAGGCTGCTGCGGAGGGAGCGG + Exonic
970945685 4:21688810-21688832 GGAAGCAGCTGGGGAGAGAGAGG - Intronic
971230839 4:24799478-24799500 GGACGCCCCCGCGGAGGTGGGGG - Intronic
978514661 4:109557727-109557749 GGACGCCGCTGAGGCAGGGGCGG - Intergenic
979033177 4:115678533-115678555 GGGCGCCGCAGAGCAGGGAGCGG + Intergenic
980130527 4:128812167-128812189 GGACGCCGCTGCGGAGGGAGCGG + Intronic
980595855 4:134953039-134953061 TGACGCCGGTGCGGGGGGCGGGG - Intergenic
985788842 5:1914655-1914677 GGAGGCTGCTGCGGAAGGTGGGG + Intergenic
987235347 5:15936616-15936638 GGACGCAGCGGCGCAGGTAGAGG - Exonic
992334334 5:75749852-75749874 GGACACCAGTGGGGAGGGAGTGG + Intergenic
992444034 5:76818924-76818946 GGGCGCAGCTGCGCAGGGAAGGG + Intronic
992812951 5:80407949-80407971 GGCCGCGGATGCCGAGGGAGGGG + Intergenic
995342260 5:111073039-111073061 GGACGCCGCCGCCGGGGGAAAGG + Intronic
996403472 5:123086615-123086637 GGAAGCCGCGGTGGAGGCAGGGG + Intergenic
998160741 5:139811448-139811470 GGAGGCTGATGCAGAGGGAGGGG + Intronic
1001381714 5:171310135-171310157 GGCCGCCGCTGCGGAGACACAGG - Exonic
1002029369 5:176416547-176416569 GGGCGCCGCGGCGGGAGGAGCGG + Exonic
1002188933 5:177468960-177468982 GGACGGCTCTGGGGAGGGAGAGG + Intronic
1002591098 5:180292056-180292078 GGGCGCCGCGGCGGCGGCAGCGG - Exonic
1003601953 6:7525922-7525944 GGATTCGGCTGTGGAGGGAGTGG + Intergenic
1004720373 6:18263954-18263976 GGCCCCTGCTGCGGAGGGGGAGG - Exonic
1010044157 6:71420775-71420797 GCGAGCCGCTGCGGAGGGAAGGG - Intergenic
1012862219 6:104573557-104573579 GGATGCCTCTTAGGAGGGAGTGG - Intergenic
1012997277 6:105986184-105986206 GGACTCAGCTCCGGCGGGAGAGG - Intergenic
1018842132 6:167524994-167525016 GGACGCTGCAGGGGAAGGAGGGG - Intergenic
1018898145 6:168035450-168035472 GAACGGCGCTGCGGGGGGGGCGG + Intronic
1018938323 6:168289427-168289449 GGAGCCAGCTGCGGGGGGAGTGG + Intergenic
1019313584 7:374540-374562 GGTAGCCGCCGCGGTGGGAGTGG - Intergenic
1019922976 7:4174546-4174568 GGGTGCAGCTGCGGAGGCAGAGG + Intronic
1026976716 7:74503191-74503213 GGGCCCCGCTGCCCAGGGAGCGG + Intronic
1029491925 7:100875352-100875374 GGGCCCCGCTGGGGCGGGAGAGG + Intronic
1029736779 7:102469559-102469581 GGAGGCCGCTGAAGAGGGGGTGG - Exonic
1035386528 7:158476541-158476563 AGACGCCGCTCGGGAGGGAGAGG + Intronic
1035389560 7:158496291-158496313 GGACGCTGCAGGGAAGGGAGAGG - Intronic
1035723658 8:1811997-1812019 GGAGGCCTCTGCAGAGGGAAGGG + Intergenic
1037861826 8:22410853-22410875 GGATGCTGCTGTGGAGGGTGAGG + Intronic
1037990293 8:23316914-23316936 GGAGCCCGGTGGGGAGGGAGGGG + Intronic
1038475160 8:27860881-27860903 GGACCATGCTGAGGAGGGAGTGG + Intergenic
1039608420 8:38901172-38901194 GGAGCCCGCCGGGGAGGGAGAGG - Intergenic
1039912092 8:41833931-41833953 GGAAGAGGCTGCGGAGGGACGGG + Intronic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1048345378 8:133571457-133571479 GGTCGCCGCTGCCAAGGAAGGGG + Intronic
1048805822 8:138240416-138240438 GGAGGCAGCTGTGGAGTGAGGGG - Intronic
1048872600 8:138811866-138811888 GGAGGCCGCTGGGGTGGGGGTGG + Exonic
1049532293 8:143160491-143160513 GGGCGCCGCGAGGGAGGGAGCGG - Intronic
1049573261 8:143379300-143379322 GAAGGCCCCTGCGGAGGGAGGGG - Exonic
1050305332 9:4299993-4300015 GGACGCGGCTGCAGGGAGAGGGG + Intronic
1052852751 9:33387772-33387794 GGAGGCCTCTGCAGAGGGAGAGG - Intronic
1053680851 9:40484313-40484335 GGAGGCCTCTGCAGAGGGAGAGG - Intergenic
1053930839 9:43112627-43112649 GGAGGCCTCTGCAGAGGGAGAGG - Intergenic
1054282862 9:63140622-63140644 GGAGGCCTCTGCAGAGGGAGAGG + Intergenic
1054293933 9:63319828-63319850 GGAGGCCTCTGCAGAGGGAGAGG - Intergenic
1054391958 9:64624317-64624339 GGAGGCCTCTGCAGAGGGAGAGG - Intergenic
1054503771 9:65892011-65892033 GGAGGCCTCTGCAGAGGGAGAGG + Intronic
1055757368 9:79571233-79571255 TGGCGCGGCTGCGGAGCGAGGGG + Intergenic
1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG + Intergenic
1058058557 9:100473261-100473283 GGACACCGCGGCGAGGGGAGCGG - Exonic
1059226146 9:112674947-112674969 GGAAGCAGCTGGGGAGGGACTGG - Intergenic
1059469796 9:114496134-114496156 GGACCCTGATGAGGAGGGAGAGG - Intronic
1061191540 9:129085384-129085406 GGATGCCCCTGGGGTGGGAGGGG + Intronic
1061317152 9:129803435-129803457 GGTCGGCGCTGCGGGGGGCGCGG + Intronic
1061615183 9:131774631-131774653 TGAAGCCGCAGGGGAGGGAGTGG - Intergenic
1061711187 9:132489023-132489045 GAAGGCAGCTGAGGAGGGAGGGG + Intronic
1061874142 9:133535527-133535549 GGAGGCTGCTGAGGAGGGAGGGG + Intronic
1061874210 9:133535837-133535859 GGTCGACGCTGAGGAGGGGGTGG + Intronic
1062321640 9:135993151-135993173 GGAGGCTGCTGCTGGGGGAGGGG + Intergenic
1203467899 Un_GL000220v1:104571-104593 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1203475720 Un_GL000220v1:148543-148565 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1186768048 X:12791404-12791426 GGAGGCTGCTGCTGCGGGAGCGG - Exonic
1186917956 X:14244134-14244156 GGACGCAGCTGTTGGGGGAGGGG - Intergenic
1187467789 X:19542104-19542126 GGGCGCCGCTGAGGACAGAGGGG + Exonic
1194117594 X:89922088-89922110 GGAGGCCGCTGCGGACGGCCCGG + Exonic
1198480258 X:137034095-137034117 GGCCGCCGCAGCCCAGGGAGCGG + Intergenic