ID: 980130727

View in Genome Browser
Species Human (GRCh38)
Location 4:128813100-128813122
Sequence CACTACCTAAATCAGCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980130727 Original CRISPR CACTACCTAAATCAGCTTTC AGG (reversed) Intronic
900564784 1:3326920-3326942 CTCTACAGGAATCAGCTTTCAGG + Intronic
906967460 1:50472453-50472475 CACAACTTGAATCAGTTTTCTGG + Intronic
911383261 1:97141928-97141950 TCCTACCAAAATCAGCATTCTGG + Intronic
916486429 1:165263833-165263855 CACTGCCTAACTTAGCTTTGGGG + Intronic
917498228 1:175562198-175562220 CACTATCTAAATAATTTTTCTGG + Intronic
918961378 1:191282638-191282660 CAAAACCTAGATCACCTTTCAGG + Intergenic
920297048 1:204964771-204964793 CTCTACCAAAAACAGCTTTTAGG - Intronic
921046040 1:211478833-211478855 TACGACCTAACTCAGCTTTGTGG + Exonic
921684754 1:218077009-218077031 CACTGCCAAAAGCAGATTTCAGG + Intergenic
924479924 1:244420585-244420607 TACTTCATAAACCAGCTTTCAGG + Intronic
1064884562 10:20096105-20096127 CTTTTCCTAAATCAGCATTCCGG - Intronic
1072035499 10:91559612-91559634 CTCTACCTAAGAAAGCTTTCCGG - Intergenic
1072742582 10:97918455-97918477 CACTTTCTAAATCAGTTTTCTGG + Intronic
1074589778 10:114801828-114801850 CACTTCCAAAATTAGCTTTAAGG + Intergenic
1079680203 11:23286826-23286848 TATTGCCTAAATCATCTTTCAGG - Intergenic
1080652027 11:34230424-34230446 CAATACCTAAAATAACTTTCGGG + Intronic
1085663985 11:78396014-78396036 GACTACCTGAATCATCTTGCAGG + Intronic
1086566185 11:88230080-88230102 CACCAACTAAATCAGTCTTCAGG + Intergenic
1091183126 11:133625445-133625467 TACTCCTTAAATCACCTTTCTGG - Intergenic
1092873268 12:12826069-12826091 CAGTAAGTAAATCAGCTTTAGGG + Exonic
1092929912 12:13306030-13306052 CACTGCCTAAATCAGTGTTTTGG - Intergenic
1095657987 12:44693924-44693946 TGCTACATAAAACAGCTTTCAGG - Intronic
1108254376 13:48596217-48596239 CACTACACAAATCTCCTTTCAGG - Intergenic
1112960432 13:105119075-105119097 TATTACCTAAATCAGAATTCTGG - Intergenic
1125001155 15:34771203-34771225 CACCACATACCTCAGCTTTCTGG + Intergenic
1128107750 15:65057037-65057059 GACTACCTTCAGCAGCTTTCAGG + Intronic
1131023893 15:89123203-89123225 GACTACCTGAAGCAGCTTCCAGG - Intronic
1136410166 16:30071798-30071820 CAGTAACTACATCAGCTCTCTGG + Intergenic
1147239474 17:39081095-39081117 CACTTCAAAAATCAGATTTCTGG + Intronic
1149277458 17:55058593-55058615 CACTACCAAATTCATCCTTCAGG - Intronic
1150329396 17:64282773-64282795 CACTCCCTAGATGACCTTTCCGG + Intergenic
1150420376 17:65028684-65028706 CACAACCTTAAGCAACTTTCAGG + Intronic
1152498672 17:80693784-80693806 CACTATCTGAGTCAGCTCTCTGG - Intronic
1154331439 18:13432358-13432380 AATTTCCTAAATCAGCCTTCAGG - Intronic
1156704927 18:39868949-39868971 GCTTACCTAACTCAGCTTTCTGG - Intergenic
1158326745 18:56321089-56321111 CTCTACCTAGAGCAGCTTTTAGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
927864179 2:26578181-26578203 CAGTACCCAAGTCATCTTTCAGG - Intronic
928805050 2:35140497-35140519 AACTCCCTATATCAGTTTTCTGG - Intergenic
930002113 2:46868598-46868620 CCCGACCTAAAACAGCTTCCAGG + Intergenic
931240507 2:60447995-60448017 CACTACCAAAACAAGCTTTTGGG + Intergenic
931370686 2:61659906-61659928 CACTGCCTAACTCAGCTACCTGG - Intergenic
933936178 2:87205562-87205584 CACTGCCTCAATCAGCTTCAAGG - Intergenic
936356972 2:111760267-111760289 CACTGCCTCAATCAGCTTCAAGG + Intergenic
936605194 2:113945013-113945035 CCCTAGGTAATTCAGCTTTCAGG - Intronic
938000921 2:127736190-127736212 CATTTCCAAAATCAGCCTTCTGG - Intronic
938207619 2:129437649-129437671 AAATACTAAAATCAGCTTTCTGG - Intergenic
939549262 2:143593253-143593275 CAGTACCTAAACCAGCTGACAGG - Intronic
944154306 2:196593853-196593875 CACTCCCCTATTCAGCTTTCTGG - Intergenic
944890795 2:204115458-204115480 CACTAACTAAATGACCTTCCTGG - Intergenic
1178606447 21:34040389-34040411 CACTACCTCAGTCAGCTGTGAGG - Intergenic
949495128 3:4624124-4624146 ATCTACCTAAATCAGTTTTTTGG + Intronic
951753354 3:26061556-26061578 ATCTACCTAAGTCAGCTGTCTGG + Intergenic
951788571 3:26452906-26452928 CATTACCTGAGTCAGCTTTCAGG - Intergenic
952822810 3:37499461-37499483 CACTACCTAAATCACATTTGTGG - Intronic
953822050 3:46215273-46215295 CCCTACCTAACTCAACTTTTAGG - Intronic
956554074 3:70498282-70498304 CACTTGCTAAATCAGGTTCCAGG - Intergenic
957203864 3:77169670-77169692 CCTTACCTAAAGCAGGTTTCTGG - Intronic
957717605 3:83950239-83950261 AACAACTTAAATAAGCTTTCAGG + Intergenic
962886803 3:139635144-139635166 CACTCCCTATACCAGCTTCCAGG + Intronic
964382248 3:156109334-156109356 CTCTACTTTAAGCAGCTTTCAGG - Intronic
966422719 3:179749674-179749696 CACCATCTAAATCTACTTTCTGG + Intronic
973933683 4:55819551-55819573 CATTATATAAATCAGCTGTCTGG - Intergenic
974424107 4:61718664-61718686 CACCAATTAAATCAGCTTCCTGG - Intronic
978099221 4:104816392-104816414 AACCATCTAAATCAGCTTACTGG + Intergenic
978515777 4:109567213-109567235 CACTGCCCAAATCACATTTCTGG + Intronic
979842327 4:125458570-125458592 AACTGCCTAATTCTGCTTTCAGG - Intronic
980130727 4:128813100-128813122 CACTACCTAAATCAGCTTTCAGG - Intronic
987080925 5:14424639-14424661 CACTACCAAGATCAGCTCTCAGG + Intronic
990638660 5:57758259-57758281 CATTTCCTAATTAAGCTTTCAGG + Intergenic
996774805 5:127121661-127121683 GACACCCTAAATCATCTTTCTGG + Intergenic
998470814 5:142382486-142382508 CACCACCTAAACCTGCGTTCCGG - Intergenic
999046240 5:148472750-148472772 CACTTCCTATTTCAGCTCTCAGG - Intronic
1001342155 5:170857362-170857384 CATTACCTACATTACCTTTCTGG - Intergenic
1005473092 6:26181577-26181599 GACTGCCTAAATCATCATTCTGG + Intergenic
1005914019 6:30336309-30336331 CAGTACATAAATCAAATTTCAGG - Intronic
1008706688 6:54169328-54169350 CACTGACTTTATCAGCTTTCTGG - Intronic
1010153358 6:72762629-72762651 CCCAAGCTAAATCAGCTTTCTGG - Intronic
1014176006 6:118331976-118331998 CACTAGCTCAGTCAGCTCTCAGG + Intergenic
1014943398 6:127469813-127469835 CACTGCATAAACCAGCTTCCCGG - Intronic
1018467123 6:164058167-164058189 CGCTTCCTAAATATGCTTTCGGG - Intergenic
1020217805 7:6208289-6208311 CCCTACCCAAATCAGCCTTTTGG + Intronic
1022682647 7:32564729-32564751 CACTTCCTGAATCAGCTCTCAGG - Intronic
1024850814 7:53714551-53714573 CACTAGCTAAATCTTCTTACTGG + Intergenic
1028184490 7:87767108-87767130 ATCTACCTAACTCATCTTTCAGG + Intronic
1028543598 7:91973014-91973036 CACTACATGAATTTGCTTTCTGG - Intronic
1033531445 7:142268026-142268048 CTCTACCTCTATAAGCTTTCTGG - Intergenic
1033890318 7:146004740-146004762 CACTACGTAGGTCAGTTTTCAGG - Intergenic
1035935267 8:3830168-3830190 CACTTCATAAATCAGCTTCATGG - Intronic
1042964890 8:74339750-74339772 GACATTCTAAATCAGCTTTCAGG + Intronic
1046181681 8:110656857-110656879 CATTTCCTGAATCAGTTTTCTGG - Intergenic
1046430958 8:114126849-114126871 CACTACTTAGAGTAGCTTTCAGG + Intergenic
1050190058 9:3015559-3015581 CTCTACCTAAATCAAGTTTTTGG + Intergenic
1052564772 9:30135400-30135422 CCCTACATAAATCAGTTTTGTGG + Intergenic
1059880758 9:118686291-118686313 CACTATATAAGTCACCTTTCTGG - Intergenic
1059908497 9:119016252-119016274 CACTGCCTAGATCATCTTCCAGG + Intergenic
1061401948 9:130373326-130373348 CACTACAGACCTCAGCTTTCAGG + Intronic
1185971016 X:4663866-4663888 AACTACTTAAATCATTTTTCTGG - Intergenic
1186174448 X:6910409-6910431 CACTATCTAGGTCTGCTTTCAGG - Intergenic
1189180121 X:38996057-38996079 CACTACCAACATCACCCTTCTGG - Intergenic
1193547242 X:82845470-82845492 CTCTACCTAAATAATCTCTCAGG - Intergenic
1196295642 X:113993840-113993862 TACGGCCTAAATCAGTTTTCCGG + Intergenic