ID: 980134866

View in Genome Browser
Species Human (GRCh38)
Location 4:128849076-128849098
Sequence ACACGCTGTCAGCCAGCGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980134866_980134867 1 Left 980134866 4:128849076-128849098 CCGGACGCTGGCTGACAGCGTGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 980134867 4:128849100-128849122 TCGCTATGACCTCAATGACATGG 0: 1
1: 0
2: 1
3: 9
4: 68
980134866_980134869 12 Left 980134866 4:128849076-128849098 CCGGACGCTGGCTGACAGCGTGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 980134869 4:128849111-128849133 TCAATGACATGGATGCTGCATGG 0: 1
1: 0
2: 0
3: 10
4: 153
980134866_980134870 16 Left 980134866 4:128849076-128849098 CCGGACGCTGGCTGACAGCGTGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 980134870 4:128849115-128849137 TGACATGGATGCTGCATGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980134866 Original CRISPR ACACGCTGTCAGCCAGCGTC CGG (reversed) Exonic
900198565 1:1390756-1390778 ACACACTGACCTCCAGCGTCCGG + Exonic
903658521 1:24963314-24963336 TCACTCGGTCAGCCAGCGGCAGG + Intronic
903741203 1:25559703-25559725 ACACACTGTCAGCCTGGGTTGGG - Intronic
920314166 1:205065860-205065882 ACGCGCTGTCCACCACCGTCTGG - Exonic
920672273 1:208013611-208013633 ACCCCCTTTCAGCCAGCATCTGG - Intergenic
921563505 1:216687347-216687369 CCACGCTGTCAGCAAGCAGCGGG + Intronic
1074126111 10:110530194-110530216 AGCCGCTGGGAGCCAGCGTCAGG - Intergenic
1076114310 10:127884825-127884847 ACACCCTGTCAGCCCGTGGCTGG - Intronic
1086960817 11:92978797-92978819 ACAAGCTGTTTGCCAGCCTCTGG + Intronic
1088172379 11:107013575-107013597 TCTCGCTGTCACCCAGGGTCTGG + Intronic
1089835199 11:121364360-121364382 ACATGCAGTCAGCTAGAGTCTGG - Intergenic
1113644310 13:111981614-111981636 ACTCGCTGCCAGCAAGCGTCAGG - Intergenic
1126783710 15:52159805-52159827 AGAGGCTGTCACCCAGGGTCAGG + Intronic
1128815644 15:70606185-70606207 ACACACTGTCAGCCAAAGGCTGG - Intergenic
1135133594 16:19872003-19872025 TCACGCTGGCGGCCAGCGGCTGG - Exonic
1136646606 16:31624589-31624611 ACTTTCTGTCAGCCAGGGTCTGG + Intergenic
1136658544 16:31731644-31731666 ACTTTCTGTCAGCCAGGGTCTGG - Intronic
1137246622 16:46711242-46711264 ACACCCTGACGGCCAGCCTCAGG + Intronic
1143099907 17:4499220-4499242 AGACGCTGTCGGGCAGCGTAAGG + Exonic
1160069378 18:75611965-75611987 ACAGGCTGTGCACCAGCGTCAGG + Intergenic
1162431164 19:10629619-10629641 TCACTCTGTCAGCCAGTGGCAGG + Intronic
1163368756 19:16890269-16890291 ACACGCTGGCGGCCAGCGGCCGG + Exonic
1163971168 19:20796880-20796902 ACACTCTGTCACCCAGCCTGCGG + Intronic
1168319484 19:55500556-55500578 ACACACTGTTCCCCAGCGTCCGG - Exonic
925719995 2:6817754-6817776 ACTCGCTCTCTGCCAGCGTGGGG + Intergenic
947916229 2:233833590-233833612 GCACGCTGTCAGCATGCGTGTGG - Intronic
1179077823 21:38140640-38140662 ACACCCTGACAGCCAGCAACAGG - Intronic
1183255109 22:36756999-36757021 ACACGGTGTCAGCCAAGGTCAGG - Intergenic
1184662009 22:45969751-45969773 ATCAGCTGTCAGCCAGCGTCTGG + Intronic
951161537 3:19429032-19429054 ATAAGTTTTCAGCCAGCGTCTGG - Intronic
954221524 3:49157879-49157901 ACACTCTGTCAGGCATCTTCTGG - Intergenic
955218734 3:57006516-57006538 ACATGCTGACAGGCAGCATCCGG + Intronic
960429206 3:117548161-117548183 ACATGTTGTCAGCCAGGGGCAGG - Intergenic
961781271 3:129321828-129321850 ACGTGGTGTCAGCCAGGGTCTGG + Intergenic
962862954 3:139421543-139421565 ACATGCTGTCAGCCACAGCCAGG - Intergenic
963809506 3:149761511-149761533 ACACGCTGTCAGACCTCCTCGGG + Exonic
969649933 4:8460014-8460036 CCACGCTGTCAGCCAGCCCTGGG + Intronic
980134866 4:128849076-128849098 ACACGCTGTCAGCCAGCGTCCGG - Exonic
986781167 5:11067024-11067046 ACATGCTGTCAGTCAGGGCCTGG + Intronic
990610674 5:57453899-57453921 ACCCTCTGCCAGCCAGGGTCTGG - Intergenic
1001965891 5:175909578-175909600 ACTCCCTGTCCGCCAGCCTCTGG - Intergenic
1002251053 5:177929623-177929645 ACTCCCTGTCCGCCAGCCTCTGG + Intergenic
1007609493 6:43140080-43140102 TCACTCTGTCAGCCAGACTCTGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1036296922 8:7544791-7544813 ATACGCTGTTACCCAGGGTCAGG - Intergenic
1036325645 8:7776228-7776250 ATACGCTGTTACCCAGGGTCAGG + Intergenic
1051265511 9:15305924-15305946 ACAGGCTGTAAGCAAGGGTCTGG + Intronic
1054734778 9:68739871-68739893 GCACGCTGTCTGCCAGCCACAGG + Intronic
1060738574 9:126082497-126082519 ACAGGCTGTGGGCCAGAGTCTGG - Intergenic
1062345963 9:136115413-136115435 TCACGCTGTCCTCCAGTGTCTGG - Exonic
1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG + Intronic
1192558307 X:72107869-72107891 AGACCCTGTCAGCCAGCCTGAGG + Intergenic
1201791519 Y:17846271-17846293 ACACGCTGTCACCCAGTCTGGGG + Intergenic
1201810035 Y:18059718-18059740 ACACGCTGTCACCCAGTCTGGGG - Intergenic
1202362120 Y:24121692-24121714 ACACGTTGTCACCCAGCCTGGGG - Intergenic
1202362953 Y:24131404-24131426 ACACGTTGTCACCCAGCCTGGGG + Intergenic
1202507825 Y:25538711-25538733 ACACGTTGTCACCCAGCCTGGGG - Intergenic
1202508659 Y:25548423-25548445 ACACGTTGTCACCCAGCCTGGGG + Intergenic