ID: 980134962

View in Genome Browser
Species Human (GRCh38)
Location 4:128849927-128849949
Sequence GCTTTTGTGCTGTAGGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980134962 Original CRISPR GCTTTTGTGCTGTAGGTACA CGG Intronic
902725597 1:18334020-18334042 GCTTTTGTGCTGCAAGGACAGGG + Intronic
903217211 1:21849986-21850008 GCTCTTGTACTGCAGCTACAGGG + Intronic
904257747 1:29267050-29267072 GCTGTTGTGTTGTAGAGACAGGG - Intronic
909743903 1:79068370-79068392 GGTTTTTTGCTGCAGGTCCAGGG - Intergenic
909964735 1:81894757-81894779 GCTTTTCTGCTGGAGTAACAAGG - Intronic
912645966 1:111391894-111391916 ACTTTTGGTCTCTAGGTACATGG + Intergenic
913676240 1:121143333-121143355 GGTTTTGTGGTGTACATACAAGG + Intergenic
914028135 1:143931277-143931299 GGTTTTGTGGTGTACATACAAGG + Intergenic
916762479 1:167829865-167829887 GCTTTTGGGCTGGAGGTAGATGG - Intronic
917638603 1:176960617-176960639 GACTTTATTCTGTAGGTACAGGG - Intronic
917834830 1:178933187-178933209 GCTTTTGTGCTGCAGGTTCTGGG - Intergenic
920361622 1:205421289-205421311 GATTTTGTTATGTAGGTAGAAGG - Intronic
920463606 1:206162171-206162193 GGTTTTGTGGTGTACATACAAGG + Intergenic
1064240174 10:13620221-13620243 GCTTTTGTGCCTTAGCTGCATGG - Intronic
1064843945 10:19629889-19629911 GCTTTTGTGCTGTTGCTAGGTGG + Intronic
1075570801 10:123542099-123542121 GTTTTTGTGCTATAGGTAAATGG + Intergenic
1076352158 10:129824540-129824562 GCTTCTGTGCTCGAGGCACATGG - Intergenic
1077323860 11:1954940-1954962 GCTTTTTTTTTTTAGGTACAAGG + Intronic
1080062276 11:27969832-27969854 GCTAGTGTGCTGAATGTACAAGG + Intergenic
1080744599 11:35097503-35097525 TCTTTTCTTCTGCAGGTACACGG + Intergenic
1085016033 11:73174614-73174636 GTGATTGTGCTGTAGGTGCATGG + Intergenic
1088109969 11:106249927-106249949 GCTTTTGTGATGTAATTTCACGG - Intergenic
1088219243 11:107550164-107550186 GCTTTTGTTCTGCAAGTACTTGG - Intronic
1202806846 11_KI270721v1_random:10135-10157 GCTTTTTTTTTTTAGGTACAAGG + Intergenic
1093739433 12:22665698-22665720 GGATTTGAGCTGAAGGTACATGG + Intronic
1096985474 12:55753396-55753418 GGAATTGTGCTCTAGGTACATGG - Exonic
1097363920 12:58690177-58690199 ACTTTTATGCTGTAGGTAATAGG + Intronic
1101992403 12:109497759-109497781 GCTTTTGTTCTGGATGCACACGG + Intronic
1103529467 12:121590635-121590657 CTTTTTGTGCTGTTGGAACAGGG + Intergenic
1103597812 12:122034854-122034876 GCTTTTGTGCTGGAGGTCAGTGG + Intronic
1104689407 12:130814037-130814059 GCTTGTGTGCAGTGGGTACTCGG - Intronic
1105074132 12:133260481-133260503 GGTTTTGTAAGGTAGGTACAAGG - Intergenic
1110169380 13:72482724-72482746 GATTATGTGCTGTGTGTACATGG + Intergenic
1110391275 13:74977488-74977510 GATATTGTGCTATAGTTACATGG + Intergenic
1110890244 13:80689593-80689615 GCTCTTGTGGTGTAGGCACATGG - Intergenic
1110896924 13:80764864-80764886 CATTTTGTTCTGTAGTTACAGGG + Intergenic
1113866751 13:113531463-113531485 GCTCTTGATCTGTATGTACAGGG - Intronic
1114871025 14:26658847-26658869 GCTCTTTTGGTGTAGGTTCATGG - Intergenic
1115086236 14:29518781-29518803 ACTTTGGTGGTGTAAGTACATGG + Intergenic
1116358092 14:43957054-43957076 GCTTTTGTGCTGAAACTACGTGG - Intergenic
1117501014 14:56351321-56351343 TCTTTTCTGCTTTAGGTAGATGG + Intergenic
1125213861 15:37246686-37246708 GGGTTTGTGCTGGAGGTGCAAGG + Intergenic
1126606228 15:50479464-50479486 AATTTTGTCCTGTAGGCACAAGG + Intronic
1127470329 15:59284209-59284231 ACATGTTTGCTGTAGGTACACGG + Intronic
1127828554 15:62728202-62728224 GTTTTTGAGCTGTAAGTAAATGG + Intronic
1128367467 15:67014528-67014550 GCTTTTCTGCTGTAGGAATCTGG + Intergenic
1129257944 15:74344786-74344808 GCATTTGTGCTGTAGGAGCAAGG - Intronic
1133313674 16:4868464-4868486 ATTTTTGTACTGTAGATACATGG + Intronic
1133578566 16:7119206-7119228 GCTCTATTACTGTAGGTACAAGG + Intronic
1134541407 16:15069665-15069687 GCTTTAGTGCTGTCTGTAAAGGG + Intronic
1134637904 16:15806921-15806943 ACTTTTGTGCTTTCGGTACCTGG - Intronic
1135359398 16:21799245-21799267 GCTTTGGTGCTGTCTGTAAAGGG + Intergenic
1135436865 16:22434222-22434244 GCTTTGGTGCTGTCTGTAAAGGG + Intronic
1135854520 16:25994936-25994958 GGTTTTATTCAGTAGGTACATGG - Intronic
1136263397 16:29097699-29097721 GCTTTGGTGCTGTCTGTAAAGGG - Intergenic
1136494250 16:30632410-30632432 GCTTTTGTTGTGTATGGACATGG + Intergenic
1136612538 16:31375381-31375403 GCCTTTGTGCTGCATGTGCAAGG - Intronic
1137819404 16:51429387-51429409 GCTGTTGTGCTGGTGGGACAGGG - Intergenic
1142642113 17:1290244-1290266 GATTTTGTCCTGCAGGAACAGGG - Intronic
1144522802 17:15965421-15965443 GCAGTTGTGTGGTAGGTACACGG + Intronic
1147915740 17:43884390-43884412 GTTTTTGTTTTGTAGGGACAGGG + Intronic
1151168020 17:72221249-72221271 CCTTTGCTGTTGTAGGTACATGG + Intergenic
1153945969 18:10017643-10017665 GCTTCTGTTCTGTGGGTACACGG + Intergenic
1153961814 18:10146735-10146757 GCTTTTGTGCTGCAGCCTCAGGG + Intergenic
1154277647 18:12976295-12976317 GCTTGTGTGTTGTAGTCACACGG + Intronic
1155368184 18:25070410-25070432 ACTTTTATACTATAGGTACATGG - Intronic
1155512807 18:26594550-26594572 GCATTTGTGCTGCAGTTACCTGG - Intronic
1157310474 18:46548971-46548993 GCTTTGGTTCTGTCGGTACAAGG - Intronic
1158569908 18:58589404-58589426 GATTTTGTGCTTTGGGAACAAGG + Intronic
1159534259 18:69695059-69695081 TCTTTTGTTCTGCTGGTACATGG + Intronic
926513398 2:13810450-13810472 GCTTTTATGCTGTAGTTTGAAGG + Intergenic
927429726 2:23017321-23017343 CCCTTTGGGCTGTAGGGACAGGG - Intergenic
927699017 2:25256210-25256232 GCTTTTGAGCTGTAGGTGGGAGG - Intronic
930234681 2:48877346-48877368 GCTGTTGAGATATAGGTACAAGG + Intergenic
930970842 2:57393815-57393837 GCCTTTGTTCAGTAGGTACCAGG + Intergenic
934116645 2:88804136-88804158 ACTTTTGTGCTATAACTACAGGG - Intergenic
934625967 2:95852418-95852440 ACTTTTGTGCTGTAACTGCAGGG + Intronic
934807608 2:97248900-97248922 ACTTTTGTGCTGTAATTGCAGGG - Intronic
934829902 2:97508287-97508309 ACTTTTGTGCTGTAATTGCAGGG + Intronic
937348651 2:121144431-121144453 CCTTTTGAGCTGTAGCTGCACGG - Intergenic
941983181 2:171482794-171482816 GCTTTTTTGCTGGGGGTAGATGG + Exonic
942784269 2:179682853-179682875 GCTTGTGTACTGTAGGTTAAGGG + Intronic
944129346 2:196330143-196330165 TCTATTGTGCTGCAGGTACATGG + Intronic
944196190 2:197055895-197055917 GCTTTTTTGTTGTTGGGACAGGG + Intronic
944946061 2:204687043-204687065 TCTTTAGTGCTGTTTGTACAAGG + Intronic
947060764 2:226162637-226162659 GTTTCTGTGCTGTATGTACTGGG - Intergenic
1169138701 20:3213970-3213992 GTCTTTGTGCTGCAGGTACAGGG + Exonic
1175213919 20:57379754-57379776 GCTTTTATGCTTTAGGTCCTGGG - Intergenic
1183093201 22:35537606-35537628 GCTCTTGTGCTGTGGGTAACTGG - Intergenic
949811181 3:8007927-8007949 GCTTTAGTACTGAAGGAACATGG - Intergenic
949968502 3:9380936-9380958 TCTTTTTTGCTTTGGGTACAGGG + Intronic
950133483 3:10563976-10563998 GCTAGTTTGCTGTAGTTACAAGG - Intronic
950902613 3:16511883-16511905 GCTTTTTGGCTGTATGGACATGG - Intronic
952260143 3:31732172-31732194 GCATTTGCTCTGTATGTACAAGG - Intronic
955824931 3:62935620-62935642 GCCTTTGTGCTGTGTGTACTAGG - Intergenic
956187857 3:66579570-66579592 TATTTTGTGCTGTATGGACAGGG + Intergenic
962866465 3:139451618-139451640 GCTTTCTTGCTGCAGGAACATGG + Intergenic
966286502 3:178302291-178302313 GGCTGTGTGCTGTAGGTATATGG - Intergenic
966829765 3:183997530-183997552 GCTGTGGTGGTATAGGTACAGGG - Intronic
968974823 4:3816560-3816582 GCCTTTGTGCTGCAGGTAGCAGG + Intergenic
969845466 4:9916918-9916940 GCTCTGGTGCTGGAGGCACAGGG + Intronic
970063091 4:12058007-12058029 GTTTTTTTGTTGTAAGTACACGG - Intergenic
976017807 4:80579876-80579898 CCTTTTGTGCTGTGGGATCAGGG + Intronic
976111671 4:81681683-81681705 GTTTTTTTACTTTAGGTACATGG - Intronic
976147656 4:82058002-82058024 GCTTTTCTGATGAAGGAACAAGG - Intergenic
976611549 4:87035586-87035608 GCTTTAGTCCTGTAGGCACCAGG + Intronic
976777551 4:88722593-88722615 GATCTTGTGCTGTAGCTCCAGGG - Intergenic
980134962 4:128849927-128849949 GCTTTTGTGCTGTAGGTACACGG + Intronic
980800627 4:137744774-137744796 GCTTTTATGCAGCAAGTACAAGG - Intergenic
981322723 4:143411197-143411219 GGTTTTATCCTGTAGGCACAGGG + Intronic
984584735 4:181550326-181550348 GCTTGTTTGCTGTAGGTAGGTGG - Intergenic
984745112 4:183207662-183207684 GCTTTTATTCTGTAGGCACTGGG + Intronic
985860010 5:2463454-2463476 GCACATGTGCTGTATGTACACGG + Intergenic
988903959 5:35765182-35765204 GCTTTTGAGCTTTAGATAAATGG + Intronic
990373207 5:55142090-55142112 GCTTCTGTTCTGTGGGTGCAGGG + Intronic
992070711 5:73146066-73146088 GCTTTTGTGCTATATTGACATGG + Intergenic
993113381 5:83687657-83687679 GCATATGTGCTGGAGATACAAGG - Intronic
994755229 5:103787043-103787065 TCTTCTGTGCTGTAGGTGCTTGG + Intergenic
994818234 5:104612731-104612753 GCTATTGTGCTGTGGATACAAGG - Intergenic
997146524 5:131440153-131440175 GCATCTGTGCTGTGGGTATACGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999952698 5:156667296-156667318 GCTTCTTAGCTGTAGGTACTTGG + Intronic
1001143533 5:169164683-169164705 GCTATTGTTCTCTAGGTCCATGG + Intronic
1001422329 5:171597240-171597262 GCTTTTGAACTGTATGTAAATGG - Intergenic
1001762077 5:174215796-174215818 AATATTGAGCTGTAGGTACAGGG + Intronic
1002925070 6:1601356-1601378 GCCTTTGTGCTGAAGGAAGAAGG + Intergenic
1003849332 6:10205628-10205650 GCATTTGTGAAGTAGCTACAGGG - Intronic
1006035705 6:31210164-31210186 GATCTTGTGATGTTGGTACATGG - Intergenic
1007746964 6:44049016-44049038 GCCTTTGTCCTGTAGGCAAAGGG - Intergenic
1008356319 6:50558019-50558041 GCTTTTCAGCAGTAGGTAGAAGG + Intergenic
1009474525 6:64072884-64072906 GCTGTTGTGCCATATGTACAAGG + Intronic
1010360420 6:74986996-74987018 GGTTTTGTGGGGTAGGTCCAGGG + Intergenic
1011897983 6:92256073-92256095 CATTTTGTGCTGTTGTTACAAGG - Intergenic
1012263661 6:97115499-97115521 GATTTTGGGTTGTGGGTACATGG - Intronic
1016325578 6:142897617-142897639 GCTTTTGTCCTTTATGTATATGG - Intronic
1018357965 6:163037704-163037726 GCGTCTGTGCTGTAGGTAACCGG - Intronic
1021909022 7:25365588-25365610 GCTTCTGTGCTGTAGGCAGCTGG + Intergenic
1023430471 7:40085890-40085912 GCTTTTGTTTGGTAGGTTCATGG - Intronic
1031584455 7:123517699-123517721 GCTTTTTTGTTGTTGGTCCATGG - Intronic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1035495023 7:159317058-159317080 GGTTTTGTAAGGTAGGTACAAGG - Intergenic
1036227175 8:6969472-6969494 GCTTTTGTTCAGTAAGTTCAGGG + Intergenic
1041398297 8:57415284-57415306 GATCTTGTGATGTTGGTACATGG + Intergenic
1041839307 8:62249474-62249496 GCGTTCGTGCTGAAGTTACACGG + Intronic
1043684897 8:83072675-83072697 AATTTTGTGATGTTGGTACATGG - Intergenic
1045765057 8:105657677-105657699 ACTTTTGTGAAGTAGCTACAAGG - Intronic
1050862659 9:10454759-10454781 GCATATGTGCTTTGGGTACAGGG - Intronic
1050958572 9:11696397-11696419 GCATTTGAGCTGTTGGTTCAAGG - Intergenic
1053882020 9:42605057-42605079 GCTTTTGGGCTGAAGGTATGAGG + Intergenic
1053890648 9:42689230-42689252 GCTTTTGGGCTGAAGGTATGAGG - Intergenic
1054221045 9:62412523-62412545 GCTTTTGGGCTGAAGGTATGAGG + Intergenic
1054229669 9:62496649-62496671 GCTTTTGGGCTGAAGGTATGAGG - Intergenic
1057904939 9:98976013-98976035 GCTTTTATGCTGAAGGCACTGGG + Intronic
1060220086 9:121759871-121759893 GCTGTTGTCCTGTATGTGCACGG - Exonic
1060389413 9:123266876-123266898 AATTTTGTGCTGTAGGGAGAAGG - Intronic
1186129878 X:6455068-6455090 GCTTGTCTGGTGCAGGTACAGGG + Intergenic
1186282447 X:8007850-8007872 GCCTTTGTGCAGTATGCACAGGG + Intergenic
1188970003 X:36603511-36603533 GTTTCTGTTCTGTAGATACATGG - Intergenic
1189214796 X:39313813-39313835 GTTTTTGTTTTGTGGGTACAAGG - Intergenic
1190834892 X:54091419-54091441 GCTTTTATTTTCTAGGTACATGG - Exonic
1193591419 X:83392738-83392760 GATCTTGTGATGTTGGTACATGG - Intergenic
1197414584 X:126159379-126159401 TCTTTTCTGATGTAGGTGCATGG + Intergenic
1197597047 X:128477792-128477814 GCTTTGGTGCTTTTGGTACTTGG + Intergenic
1201797704 Y:17917703-17917725 TATTTTGTTCTGTAGCTACAAGG - Intergenic
1201803849 Y:17988254-17988276 TATTTTGTTCTGTAGCTACAAGG + Intergenic
1201924976 Y:19274178-19274200 GGTTTTGTGGTCTAGGTCCAGGG - Intergenic
1202359045 Y:24086442-24086464 TATTTTGTTCTGTAGCTACAAGG - Intergenic
1202511733 Y:25583672-25583694 TATTTTGTTCTGTAGCTACAAGG + Intergenic