ID: 980138007

View in Genome Browser
Species Human (GRCh38)
Location 4:128879376-128879398
Sequence TATAGGTTCTCCAAGTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980138007_980138011 10 Left 980138007 4:128879376-128879398 CCATGACACTTGGAGAACCTATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 980138011 4:128879409-128879431 TTGAATCACTGTCAGCAAATGGG 0: 1
1: 0
2: 0
3: 12
4: 160
980138007_980138012 15 Left 980138007 4:128879376-128879398 CCATGACACTTGGAGAACCTATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 980138012 4:128879414-128879436 TCACTGTCAGCAAATGGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 206
980138007_980138010 9 Left 980138007 4:128879376-128879398 CCATGACACTTGGAGAACCTATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 980138010 4:128879408-128879430 TTTGAATCACTGTCAGCAAATGG 0: 1
1: 0
2: 2
3: 29
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980138007 Original CRISPR TATAGGTTCTCCAAGTGTCA TGG (reversed) Intronic
904716892 1:32475131-32475153 TATAGTTTTTCCAAGTGCTAAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906765412 1:48426428-48426450 TATAGTTTTTCCTAGTGTCTTGG - Intronic
911736265 1:101339554-101339576 TATAGGTTGTCTGAGTGACAAGG + Intergenic
913640033 1:120803898-120803920 TGCAGGTTCACAAAGTGTCATGG - Intergenic
914278446 1:146146440-146146462 TGCAGGTTCACAAAGTGTCATGG + Intronic
914539493 1:148597388-148597410 TGCAGGTTCACAAAGTGTCATGG + Intronic
914627188 1:149474240-149474262 TGCAGGTTCACAAAGTGTCATGG - Intergenic
915033806 1:152906070-152906092 CAAAGCTTCTCCATGTGTCATGG + Intergenic
916108143 1:161445324-161445346 TATCGTCTCTCCAAATGTCAAGG - Intergenic
916109729 1:161452704-161452726 TATCGTCTCTCCAAATGTCAAGG - Intergenic
916111315 1:161460115-161460137 TATCGTCTCTCCAAATGTCAAGG - Intergenic
916112902 1:161467495-161467517 TATCGTCTCTCCAAATGTCAAGG - Intergenic
1063425370 10:5946319-5946341 TGTAGTGTCTCCAAGTGACAGGG + Intronic
1066750268 10:38648599-38648621 TATAGTTTCTCTTAGTGTTAGGG - Intergenic
1069273626 10:66562485-66562507 TATAGGCTCTCAAAGAGTAAAGG - Intronic
1069495191 10:68897337-68897359 GATAGGTTCTCAAAATGCCATGG - Intergenic
1070400325 10:76047550-76047572 TTTAGGTTTTCCAAGTTACATGG + Intronic
1070438605 10:76418998-76419020 GAAAGGCTGTCCAAGTGTCAAGG - Intronic
1072014402 10:91332537-91332559 TAGAGGTTCAACAAGTGTCTTGG - Intergenic
1073842907 10:107518701-107518723 TATTGGCTTTGCAAGTGTCAAGG - Intergenic
1078035107 11:7795565-7795587 TCTAGGTTATAAAAGTGTCAAGG + Intergenic
1080510112 11:32960710-32960732 TATAGTTTCTTCAAATGACAAGG + Intronic
1091987736 12:4926334-4926356 TATAAGTTCTCCAATAGTGAAGG + Intronic
1092059477 12:5536740-5536762 TATGGGTTTTTCAAGTGTGAGGG - Intronic
1092069209 12:5619123-5619145 TAGAGGCTCTCCAAGACTCAGGG - Intronic
1097911623 12:64976286-64976308 TAAATGTTCTCCAAGCTTCAGGG + Intergenic
1098617099 12:72540109-72540131 GATGGGCTCTCCAACTGTCATGG - Intronic
1099320891 12:81147270-81147292 ACTAAGTTCTACAAGTGTCAAGG + Intronic
1099651057 12:85428918-85428940 TATGGGCTCTCCAAGTGGTATGG + Intergenic
1100048039 12:90409348-90409370 GATAGGTAATCCAAGGGTCAAGG - Intergenic
1100120214 12:91360814-91360836 AATAGTTTCACCAAATGTCATGG - Intergenic
1100252722 12:92845831-92845853 TTTGGGTCTTCCAAGTGTCAGGG - Intronic
1102320338 12:111927961-111927983 TATATGGCCTACAAGTGTCATGG + Intergenic
1102614486 12:114141465-114141487 TATAGATGGTCCAAGTTTCAGGG - Intergenic
1104166352 12:126233948-126233970 CATAGGTTATCCAATTCTCATGG + Intergenic
1108106623 13:47017504-47017526 TACATGTTCTCCAAGTGAAATGG - Intergenic
1109151475 13:58853431-58853453 TAAAGGTTAGCCAAGTGTGATGG + Intergenic
1111186880 13:84749122-84749144 TATTTGTTCTTCAAGTTTCATGG + Intergenic
1111562726 13:89972161-89972183 TAAAGGTACTCCAAGAGACATGG - Intergenic
1112115542 13:96348238-96348260 TATAGATTCTGCAAGAGTGAAGG + Intronic
1136732446 16:32428471-32428493 TATAGTTTCTCTTAGTGTTAGGG + Intergenic
1203020635 16_KI270728v1_random:401114-401136 TATAGTTTCTCTTAGTGTTAGGG - Intergenic
1203038970 16_KI270728v1_random:674272-674294 TATAGTTTCTCTTAGTGTTAGGG - Intergenic
1146773891 17:35595246-35595268 TAAAGGTTCTCCAGGTGGCCAGG + Intronic
1148379811 17:47188285-47188307 TACAGTTTCTCCAGATGTCAGGG + Intronic
931867622 2:66429554-66429576 TATAGAATCTTCAAGTCTCACGG - Intergenic
932101907 2:68908857-68908879 TGAAGGTTCTCCAAGGGGCAGGG - Intergenic
932548783 2:72744558-72744580 TTCACGTTCTCCAAGTGTCAAGG - Intronic
934313263 2:91890776-91890798 TATAGTTTCTCTTAGTGTTAGGG - Intergenic
939850819 2:147302106-147302128 TAAAGGTTCACCTACTGTCATGG + Intergenic
939879601 2:147614815-147614837 TAAACGTTCTGCAAGTGGCATGG + Intergenic
940110351 2:150146164-150146186 TATAGCTTCTCCATGTGTCTTGG - Intergenic
941296941 2:163750510-163750532 CAGTGGTCCTCCAAGTGTCAAGG + Intergenic
944091248 2:195914446-195914468 TATAGGTTCTTCAAGTGATTGGG + Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1180540000 22:16436649-16436671 TATAGTTTCTCTTAGTGTTAGGG - Intergenic
1183269930 22:36855117-36855139 TCTAGGCCCTCCAAATGTCAGGG - Intergenic
1183307019 22:37088015-37088037 TAGAGCTTCTCCAAGGGTCTGGG + Intronic
1185001172 22:48246983-48247005 TATATGTTCTCAACATGTCATGG - Intergenic
949332268 3:2935621-2935643 TCAAGGTTCTACATGTGTCACGG + Intronic
950654988 3:14431011-14431033 TAAAGGTTTGCCAAGTGCCAGGG - Intronic
951590994 3:24264457-24264479 GAAAGCTTTTCCAAGTGTCAGGG - Intronic
953700888 3:45194944-45194966 CATAGCTCCTCCAAGTGTCACGG - Intergenic
955661389 3:61303138-61303160 CTTATGTTCTCAAAGTGTCAGGG + Intergenic
960485039 3:118241324-118241346 TATAGATAATCCAATTGTCAGGG + Intergenic
960985294 3:123275568-123275590 TAAAGGTTCTCCATGTCTTAAGG - Intergenic
962063663 3:131956738-131956760 TATATGTTCTCCAAGATTCAAGG - Intronic
966234552 3:177686353-177686375 TAAATATTCTCTAAGTGTCAGGG - Intergenic
972896983 4:43634522-43634544 TATAGTTTCTCCAACTCTCTGGG + Intergenic
977785068 4:101023246-101023268 TATAGTTTCTCCAAAAGTGAAGG + Intergenic
978008638 4:103651517-103651539 AAAATGTTGTCCAAGTGTCAAGG + Intronic
978514710 4:109558034-109558056 TAAAGGTTCTCCAAGTCCCCAGG - Intergenic
980138007 4:128879376-128879398 TATAGGTTCTCCAAGTGTCATGG - Intronic
981423256 4:144575472-144575494 TGTCTGTTTTCCAAGTGTCAGGG + Intergenic
982847539 4:160272489-160272511 AATTGGATCTCCAGGTGTCAGGG + Intergenic
986954243 5:13131067-13131089 CATAGGTTATACATGTGTCATGG - Intergenic
987102040 5:14600083-14600105 TATATAATCCCCAAGTGTCATGG + Intronic
987207040 5:15638484-15638506 TATAACTTCTCCAAGTGACTTGG + Intronic
988410672 5:30881591-30881613 TATAGGATTTACAAGTGTGATGG - Intergenic
992425139 5:76649290-76649312 TCCAGGTTCTACAAGTGTCTGGG - Intronic
993789615 5:92192192-92192214 TATAACTTCTCCAAGTGTGTTGG - Intergenic
994169727 5:96645159-96645181 TAGATGTACTCCAACTGTCAAGG - Intronic
994972486 5:106759182-106759204 TATAGGTTCTGGAAGTGTTTTGG - Intergenic
998484642 5:142491066-142491088 TAAAGGATCACCCAGTGTCAGGG - Intergenic
1001143791 5:169166801-169166823 TCTACATTCTCCAAGTGACATGG - Intronic
1004810465 6:19255285-19255307 TATATGTTCTCCAAGTACAATGG - Intergenic
1005277652 6:24237311-24237333 TGTAGGTAAACCAAGTGTCACGG - Intronic
1006013437 6:31061672-31061694 CTCAGGTTCTCCAAGTGTAAGGG - Intergenic
1006695351 6:35926205-35926227 CATTGGTTCTCCAGGGGTCAGGG - Intergenic
1007939485 6:45765899-45765921 GATAAGGTCTCCAAATGTCATGG + Intergenic
1008922655 6:56859008-56859030 TATATGTTCCCCTAGTGCCAAGG - Intronic
1011078320 6:83461920-83461942 TGTAGGACCTCCAAGTGTCATGG - Intergenic
1021491664 7:21225746-21225768 TTTAAGTTCAACAAGTGTCAGGG - Intergenic
1024839000 7:53561923-53561945 TATTGGTTCACCAAGTTACATGG - Intergenic
1027690303 7:81336963-81336985 TCTAGGTTCTGGAAGAGTCAAGG + Intergenic
1031181687 7:118426724-118426746 TATAGCTTCACCAAGAATCAAGG + Intergenic
1031517184 7:122715826-122715848 TATTGTTTCTGCTAGTGTCAGGG - Intronic
1037296862 8:17410988-17411010 TATAGTTTCACCAAGTATAATGG + Intronic
1037899021 8:22676773-22676795 TATAGGCTCTCCACGTGGGAAGG - Intergenic
1038431442 8:27503446-27503468 CATATGTTCTCCAAGAGACATGG - Intronic
1038560404 8:28572995-28573017 TAGAGGTACTCCAGGTGTCTTGG + Exonic
1038973764 8:32668418-32668440 TGTAGGTTATTGAAGTGTCAGGG + Intronic
1039449486 8:37660320-37660342 TATAGGTTGGCCAACTGTCCTGG - Intergenic
1041006247 8:53499390-53499412 TGTAGTTTCTCCACGTGGCATGG + Intergenic
1045625435 8:104042670-104042692 TATATGTTATACAAGTTTCAGGG + Intronic
1046020644 8:108660528-108660550 CAGAGTTTCTCTAAGTGTCAGGG - Intronic
1050952082 9:11610285-11610307 TACAGGATCTCCATGTGTCCTGG + Intergenic
1055921445 9:81465455-81465477 TACAGCTTCTCCCAGTGTCTTGG - Intergenic
1056138024 9:83648204-83648226 TAGACTTTCTCCAAGTGTGATGG - Intergenic
1059162056 9:112043752-112043774 TCTAGCTTCTTAAAGTGTCAAGG - Intronic
1060718555 9:125957650-125957672 TATAGCTTCTCTGATTGTCAAGG + Intronic
1186756876 X:12680511-12680533 CATAGGCTCTCCAAGTCTGAAGG - Intronic
1189055550 X:37695974-37695996 TATTGTTTTTCCAAGTGGCAGGG + Intronic
1192008864 X:67247016-67247038 TATAAGTTCTCAAAGTGCGAGGG + Intergenic
1194084269 X:89506449-89506471 TCTAAGTCCTCCAAGTGTCTAGG + Intergenic
1194725909 X:97397036-97397058 TATAGGTTGTTCATGTGTGAGGG - Intronic
1198471068 X:136947452-136947474 TATAGGTTCTCCAAGACCTAGGG + Intergenic
1198575986 X:138010768-138010790 TATATGCTCTCCTAGTGACAGGG - Intergenic
1200436908 Y:3162336-3162358 TCTAAGTCCTCCAAGTGTCTAGG + Intergenic