ID: 980140845

View in Genome Browser
Species Human (GRCh38)
Location 4:128914666-128914688
Sequence CTGACTATAGAGGTGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980140845 Original CRISPR CTGACTATAGAGGTGCACAA AGG Intronic
904105039 1:28073055-28073077 TTGACTATAAAGAGGCACAAGGG + Intronic
906458672 1:46020664-46020686 CTGACTTCAAAGGGGCACAAGGG - Intronic
907769694 1:57448229-57448251 CAGTCTAAATAGGTGCACAAGGG + Intronic
907869312 1:58428932-58428954 CTGACTACAAAGGGGCACAAGGG + Intronic
908413277 1:63887519-63887541 TTGACTAGAAAGGAGCACAAGGG - Intronic
911325063 1:96461622-96461644 CTGGCTACAGAGCTGCAAAAAGG + Intergenic
919564376 1:199165679-199165701 CTGACTCTAGAGCTGTACACTGG + Intergenic
1065238939 10:23686204-23686226 CTGACTATAGACATTTACAAAGG + Intergenic
1068732025 10:60368941-60368963 CTGACTATAGAAGGGAATAAAGG + Intronic
1069282550 10:66673205-66673227 CTGACTAAAGTGGTGCTAAATGG - Intronic
1069770459 10:70895459-70895481 TTGACTACAGAGGGGCACAAGGG + Intergenic
1075492791 10:122887620-122887642 ATGACTATAGAGCAGCATAAAGG - Intergenic
1076531869 10:131150278-131150300 GTGACTCTAGAGGAGCACACAGG - Intronic
1081264553 11:41004087-41004109 TTGACAATAGAAGTGAACAATGG - Intronic
1085597687 11:77824720-77824742 TTGACTAGAAAGGGGCACAAGGG + Intronic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1094746583 12:33351223-33351245 CTGACTACAGATGTGCTCTATGG - Intergenic
1099104849 12:78485156-78485178 CTAACTTGAGAGGTGCAAAACGG - Intergenic
1100071244 12:90721172-90721194 TTGACTATAAAGGGGCACAAAGG - Intergenic
1102468832 12:113147669-113147691 TTGATTATAAAGGGGCACAAGGG + Intergenic
1103112619 12:118294267-118294289 CTGACTGCAGAGGAGCAAAAGGG - Intronic
1106008490 13:25794543-25794565 GTGACTACAAAGGAGCACAAAGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107399864 13:40058995-40059017 CTGACTACAGAGGCCCAGAATGG - Intergenic
1107461241 13:40605726-40605748 CTGACTAGAGAGGTGGAAAAGGG - Intronic
1113072598 13:106435917-106435939 GTGACTACATAGGTGCAGAATGG - Intergenic
1114366294 14:22030307-22030329 TTGACTAAAAAGGGGCACAAAGG + Intergenic
1115640641 14:35333631-35333653 CTGACTACAGGGGTGCGGAAAGG + Intergenic
1121058774 14:90884100-90884122 CTCACTATAGAGGTGCAAAGAGG - Intronic
1121670792 14:95709504-95709526 CTGTCTATAGAGGTACAGGAGGG + Intergenic
1122673282 14:103388651-103388673 CTGACTATACAGGGCCATAAGGG - Intronic
1131912393 15:97222271-97222293 CTGTCTGTAAAGGAGCACAAGGG - Intergenic
1132125355 15:99218969-99218991 CTCACTATAGGGAGGCACAATGG + Exonic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1140074676 16:71686569-71686591 CTGACTGTAAAGGAGCACAGAGG - Intronic
1144216553 17:13060381-13060403 TTGATTATAGATGTACACAATGG - Intergenic
1144409977 17:14991309-14991331 TTGACTACAAAGGGGCACAAGGG + Intergenic
1153646035 18:7196940-7196962 CTGACTCTAAAGGGGCACAAAGG - Intergenic
1153884520 18:9451627-9451649 CTGATTAGGAAGGTGCACAAAGG + Intergenic
1158187400 18:54785903-54785925 GTGACTATAGAGGCCCAAAAAGG + Intronic
1160277450 18:77451051-77451073 CTGACCATATAGGTGCCCAAGGG - Intergenic
1167681245 19:50922864-50922886 TTGACTATATGGGTGCACAGCGG - Intergenic
928300627 2:30121183-30121205 CTGGCAATACAGGTGTACAAAGG + Intergenic
929580250 2:43077689-43077711 TTGACTGGAGAGGGGCACAAGGG + Intergenic
932029215 2:68165950-68165972 CTGACCATAAAGATGCACGAGGG - Intronic
932638222 2:73412228-73412250 CTGACTACAAAGGGGCACACAGG - Intronic
936681180 2:114773224-114773246 CTGACTAAAAAGGGGCACAAGGG + Intronic
937469475 2:122162940-122162962 CTGACCATTGAGGGGCACCATGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939368112 2:141261492-141261514 TTGACTGTAGAGGTGCAAAGGGG - Intronic
939699795 2:145376413-145376435 ATCACTATAGCGGTGAACAAGGG - Intergenic
939916176 2:148046579-148046601 CTGACTATGGAGGTAAAGAAGGG - Intronic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940271918 2:151900308-151900330 CTGACTTTGGAGTTGCAAAAAGG + Intronic
942510123 2:176689222-176689244 TTGACTAGAAAGGTGCACAAGGG + Intergenic
944248306 2:197555813-197555835 CTGAGTATGGTGGTGCACACTGG + Intergenic
946241317 2:218357611-218357633 CTGACCATTGAGGTGCAGAGAGG + Exonic
947580457 2:231313612-231313634 CTGACTACAAATGTGCACAAGGG - Intronic
947706244 2:232278444-232278466 CTGACTACAGAGGGGCACGTGGG - Intronic
1170521811 20:17193920-17193942 CTGATTACAGAGGGGTACAAGGG - Intergenic
1172184104 20:33020686-33020708 CTGACTATAGTGGCACACACAGG - Intronic
1175361913 20:58418593-58418615 CTAACTATTGAGGTGCAAAGGGG - Intronic
1177824474 21:26066898-26066920 CTGGCCAGAGAGGTGCACATAGG + Intronic
1179648986 21:42794482-42794504 CTGATTATAGGGGTGAAGAAAGG + Intergenic
1183564795 22:38606300-38606322 CAGACTACAGATGTGCACCATGG + Intronic
1183914053 22:41102500-41102522 TTGACTGTAGAGGTGAGCAAGGG + Intronic
1184260284 22:43311292-43311314 CTTACTATGGTGGTGAACAAAGG - Intronic
1185192225 22:49446252-49446274 CTGACTCTAGAGGTTCCCCAAGG + Intronic
952280354 3:31917058-31917080 CTCATTATTGATGTGCACAAGGG - Intronic
953937520 3:47058775-47058797 CTGACTACAAAGGGGCACAGGGG + Intronic
957684696 3:83486643-83486665 CTGAATCTGGAGGTGGACAAGGG + Intergenic
961758612 3:129147757-129147779 TTGACTATAGTGATGCATAAGGG - Intronic
962081831 3:132147950-132147972 CTGCCTATAAAGGGGCTCAAGGG + Intronic
963940496 3:151091764-151091786 ATGACTGCAGAGGTGAACAAGGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
973838629 4:54837760-54837782 CTGCCCATAGAGGAGAACAATGG - Intergenic
975218286 4:71782632-71782654 CTGACTCAATAGGTGCACATTGG - Intronic
975445125 4:74454893-74454915 CTGTATATAAAGGTGCACGAAGG + Exonic
980140845 4:128914666-128914688 CTGACTATAGAGGTGCACAAAGG + Intronic
981962410 4:150557065-150557087 CTGATTCTAGAGCTGCAGAAGGG + Intronic
990330532 5:54720886-54720908 CTGATTACAGAGGTACACATTGG - Intergenic
990998996 5:61764171-61764193 CTGACTAGAGAGGTGAAAAGGGG - Intergenic
993453346 5:88099116-88099138 CTGACTTTAGAGATGAATAAAGG + Intergenic
996180634 5:120415183-120415205 CTGGCTAAAGAGCTGCATAAAGG - Intergenic
996622043 5:125517628-125517650 TTGACTAAAAAGGGGCACAAAGG - Intergenic
997210544 5:132074464-132074486 CTGACTACAGAGAGGCACAGAGG + Intronic
999011469 5:148045840-148045862 CTGACTACATAGGTACACATGGG - Intronic
999087882 5:148909519-148909541 CTGACTGCAGAGGGGCACAAGGG + Intergenic
1001782059 5:174377571-174377593 ATGAATATATAGTTGCACAATGG + Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1011414538 6:87103907-87103929 TTAACTACAAAGGTGCACAAAGG + Intergenic
1014014419 6:116513673-116513695 CTGACTACAGAGGTTCAGATAGG + Intronic
1014644941 6:123961081-123961103 CAGACTATAGAATTGAACAAGGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1022132894 7:27420493-27420515 GGGACTATAGATGTGCACCACGG - Intergenic
1023137136 7:37064029-37064051 CTAACTATAGAGGAGCTCCATGG + Intronic
1025000013 7:55308023-55308045 CTGACTGTGGAGGTGCATACAGG + Intergenic
1030289664 7:107859408-107859430 CTGACTATAAAGGGACATAAGGG + Intergenic
1033706281 7:143887946-143887968 GTGACTAGAGAGGAACACAAAGG + Intronic
1038092236 8:24267465-24267487 CTGACTCTAGAGGTGCAGATGGG + Intergenic
1039309789 8:36304425-36304447 CTGCCTATAGAGTATCACAAAGG + Intergenic
1043836698 8:85055828-85055850 CTCAGTGTAGAAGTGCACAACGG - Intergenic
1051530502 9:18097066-18097088 CTGACTAGGAAGGTGGACAAGGG - Intergenic
1053677069 9:40442678-40442700 CTGCCAAGAGAGGTCCACAATGG - Intergenic
1054507554 9:65933621-65933643 CTGCCAAGAGAGGTCCACAATGG + Intergenic
1055465162 9:76558379-76558401 TTGACTATAGAGGAACAGAATGG - Intergenic
1062483553 9:136763352-136763374 CTCACTGTAGAGCTGCACCATGG + Exonic
1186861024 X:13672637-13672659 GTGACTACAGATGGGCACAAGGG + Intronic
1187216806 X:17285034-17285056 ATGACTACAAAGGGGCACAAGGG - Intergenic
1187570951 X:20501087-20501109 TTGACTATAAAAGGGCACAAGGG - Intergenic
1190218315 X:48494556-48494578 CTCTCTACAGAGGTGCAAAATGG - Intergenic
1193134487 X:77955086-77955108 GTGACTTGAGAGGAGCACAAAGG - Intronic
1194514416 X:94833667-94833689 GTGACTAAAGAGGTTGACAAGGG + Intergenic
1195404864 X:104501761-104501783 CTGACTCTAGAGTTCCAAAAAGG - Intergenic
1195501795 X:105610437-105610459 TTGCCTACAGAGGGGCACAAAGG - Intronic
1197857064 X:130925752-130925774 CTGACTGCACAGGGGCACAAGGG - Intergenic
1201557369 Y:15277081-15277103 GTGACACTAGAGATGCACAAAGG + Intergenic