ID: 980142840

View in Genome Browser
Species Human (GRCh38)
Location 4:128941908-128941930
Sequence GCACCATTGCAGTTCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1816
Summary {0: 1, 1: 0, 2: 3, 3: 87, 4: 1725}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980142840 Original CRISPR GCACCATTGCAGTTCAGTGG GGG (reversed) Intronic
900657277 1:3764990-3765012 GCACCATTGCACTCCAGTCTGGG + Intronic
900754223 1:4422628-4422650 TCATCACTGCAGTTCAGGGGTGG - Intergenic
900835840 1:5003304-5003326 GCACCATTGCATTCCAGTCTGGG - Intergenic
901073143 1:6533928-6533950 GCACCATTGCAGTCCAGCCTGGG - Intronic
901088395 1:6625632-6625654 GCACCTGGGCAGTGCAGTGGAGG + Intronic
901268421 1:7930724-7930746 GCACCATTGCACTTCAGCCTGGG + Intronic
901419575 1:9141791-9141813 GCACCATTGCACTCCAGCTGGGG - Intergenic
901488870 1:9585741-9585763 GCACCATTGCAGTCCAGCTTGGG + Intergenic
901588704 1:10320767-10320789 GCACCATTGCACTCCAGCGTGGG - Intronic
901675637 1:10882082-10882104 GCACCATTGCACTCCAGTGTGGG + Intergenic
901847058 1:11990101-11990123 GAACCCTAGAAGTTCAGTGGTGG + Intronic
901877704 1:12176174-12176196 GCACCATTGCACTCCAGTCTGGG + Intronic
901937630 1:12637467-12637489 GCACCATTGCACTCCAGTCTGGG - Intergenic
902041800 1:13497915-13497937 GCACCATTGCACTTCAGCCTGGG + Intronic
902442243 1:16438312-16438334 GCACCATTGCACTCCAGTGTGGG + Intergenic
902589871 1:17466165-17466187 GCACCATTGCACTCCAGCGTGGG - Intergenic
902860979 1:19245396-19245418 GCACCATTGCACTTCAGCCTGGG + Intronic
902865540 1:19275366-19275388 GCACCATTGCACTCCAGCCGAGG + Intergenic
903048128 1:20579742-20579764 GCACCACTGCACTTCAGTCTGGG + Intergenic
903455947 1:23486889-23486911 GCACCATTGCACTTCAGCCTGGG - Intergenic
903476770 1:23624896-23624918 GCACCATTGCATTTCAGCCTGGG - Intronic
903513345 1:23892971-23892993 GCACCATTGCACTTCAGCCTGGG + Intronic
903593678 1:24477937-24477959 GCACCATTGCACTCCAGCGTGGG - Intergenic
903639630 1:24849404-24849426 GCACCACTGCAGTCCAGTCTGGG - Intergenic
903701489 1:25251931-25251953 GCACCACTGCACTTCAGTCTGGG - Intronic
903730198 1:25488092-25488114 GCACCATTGCACTCCAGTCTGGG - Intronic
903815084 1:26059065-26059087 GCACCACTGCACTCCAGCGGGGG - Intronic
903823789 1:26127095-26127117 GCACCATTGCACTTCAGCCTGGG + Intergenic
903824293 1:26131815-26131837 GCACCATTGCACTCCAGTCTGGG - Intergenic
903887602 1:26549920-26549942 GCACCATTGCACTCCAGTCTGGG - Intronic
903950969 1:26995671-26995693 GCACCATTGCACTTCAGCCTGGG - Intronic
904010304 1:27385882-27385904 GCACCATTGCATTTCAGCCTGGG - Intergenic
904086228 1:27910816-27910838 GCACCACTGCACTCCAGCGGGGG + Intronic
904445978 1:30573294-30573316 GCTGCTTTGCAATTCAGTGGTGG - Intergenic
904608152 1:31709991-31710013 GCACCATTGCAGTCCAGCCTGGG + Intergenic
904697996 1:32341204-32341226 GCACCACTGCACTCCAGTGTGGG + Intergenic
904847663 1:33432304-33432326 GCACCATTGCACTCCAGTCTGGG - Intergenic
905052949 1:35067830-35067852 GCACCATTGCACTCCAGTCTAGG + Intronic
905057745 1:35110889-35110911 GCACCATTGCACTCCAGTCTGGG + Intronic
905070202 1:35218770-35218792 GCACCATTGCACTCCAGTCTGGG + Intergenic
905078016 1:35291678-35291700 GCACCATTGCACTCCAGCCGGGG - Intronic
905100800 1:35520434-35520456 GCACCACTGCACTTCAGTGTGGG - Intronic
905132448 1:35770970-35770992 GCACCACTGCACTTCAGCGTAGG + Intergenic
905195567 1:36274673-36274695 GCACCATTGCACTCCAGTCTGGG - Intronic
905217541 1:36420016-36420038 GCACCATTGCACTCCAGTCTGGG - Intronic
905347976 1:37324298-37324320 GCACCATTGCACTTCAGCCTGGG + Intergenic
905455507 1:38085394-38085416 GCACCACTGCACTCCAGTGTGGG + Intergenic
905572020 1:39013695-39013717 TCACCATTGCAGTCCAGCTGAGG + Intergenic
905730392 1:40295231-40295253 GCACCATTGCAGTCCAGCCTGGG - Intergenic
905795532 1:40814094-40814116 GCACCATTGCACTCCAGTCTGGG - Intronic
905978231 1:42196648-42196670 ACACCATTGCACTTCAGTCTGGG + Intronic
906012217 1:42538285-42538307 GCACCACTGCACTCCAGTGTGGG + Intronic
906103549 1:43278225-43278247 GCACCATTGCAGTGCAGCCTGGG + Intergenic
906337927 1:44950729-44950751 GCACCATTGCACTCCAGTCTGGG - Intronic
906395563 1:45460594-45460616 GCACCATTGCACTTCAGCCTGGG - Intronic
906467024 1:46091181-46091203 GCACCATTGCACTCCAGTCTGGG - Intronic
906622852 1:47298784-47298806 ACACCATTGCACTTCAGTGTGGG - Intronic
906638050 1:47423169-47423191 GCACCATTGCACTCCAGTCTGGG + Intergenic
907035991 1:51216638-51216660 GCACCACTGCACTTCAGTCTGGG + Intergenic
907211923 1:52831121-52831143 GCACCATTGCACTCCAGCGTGGG + Intergenic
907499650 1:54869022-54869044 GCACCATTGCACTCCAGTCTGGG + Intronic
907655516 1:56338252-56338274 GCACCATTGCACTCCAGTCCGGG - Intergenic
907675337 1:56512567-56512589 GCACCACTGCAGTTCGGTCTGGG + Intronic
908234392 1:62136068-62136090 GCACCATTGCATTCCAGTCTGGG - Intronic
908255952 1:62303914-62303936 GCACCATTGCACTTCAGCCTGGG - Intronic
908273472 1:62444214-62444236 GCGCCATTGCAGTCCAGTCTGGG + Intronic
908367575 1:63442044-63442066 GCACCATTGCAGTCCAGCCAGGG + Intronic
908391290 1:63685979-63686001 GCACCACTGCACTCCAGTTGGGG - Intergenic
908673827 1:66578712-66578734 GCACCATTGCACTCCAGTCTAGG - Intronic
908763131 1:67530623-67530645 GCACCATTGCACTTCAGCCTGGG + Intergenic
909312751 1:74174423-74174445 GCACCATTGCAGTGCAGCCTGGG - Intronic
909360338 1:74751625-74751647 GCACCATTGCACTCCAGCCGGGG + Intronic
909433962 1:75619025-75619047 GCACCATTGCACTCCAGTCTGGG + Intergenic
909454706 1:75837427-75837449 GCACCATTGCACTCCAGGGTAGG - Intronic
909626568 1:77723704-77723726 GCACCACTGCACTCCAGTGTGGG - Intronic
909645496 1:77912034-77912056 GCACCATTGCACTCCAGTCTGGG + Intronic
909652114 1:77987304-77987326 GCACCACTGCACTTCAGTTTGGG - Intronic
909740376 1:79021992-79022014 GCACCATTGCACTCCAGCTGAGG - Intergenic
909772076 1:79436383-79436405 GCACCATTGCACTGCAGTCTGGG - Intergenic
910114905 1:83721341-83721363 GCACCACTGCAATTCAGCGGGGG - Intergenic
910215200 1:84837065-84837087 GCACCATTGCACTTCAGCCTGGG - Intronic
910315444 1:85877403-85877425 GCACCATTGCACTTCAGCCTGGG - Intronic
910408084 1:86911824-86911846 GCACCATTGCACTCCAGTCTGGG - Intronic
910860681 1:91740100-91740122 GCACCATTGCACTTCAGCCTGGG - Intronic
910895101 1:92060921-92060943 GCACCATTGCACTCCAGTCTGGG - Intronic
910986170 1:93007107-93007129 GTACCATTGCACTCCAGTCGGGG + Intergenic
911003205 1:93189703-93189725 GCACCATTGCACTTCAGCCTGGG - Intronic
911037261 1:93564335-93564357 GCACCATTGCACTTCAGCCTGGG - Intronic
911107937 1:94152068-94152090 GCACCATTGCACTTCAGCCTAGG - Intronic
911455115 1:98112557-98112579 GCACCATTGCAGTCCAGCCTGGG + Intergenic
911556959 1:99356412-99356434 GCACCATTGCACTCCAGTCTGGG - Intergenic
912875847 1:113358658-113358680 GCACCATTGCACTCCAGTTTGGG + Intergenic
913241882 1:116836634-116836656 GCACCATTGCACTCCAGTCTGGG - Intergenic
913654733 1:120949996-120950018 GCACCATTGCAGTTCAGCCCGGG - Intergenic
914245296 1:145881240-145881262 GCACCATTGCACTCCAGTCTGGG + Intronic
914723570 1:150309037-150309059 GCACCATTGCACTCCAGTCTGGG - Intergenic
914729523 1:150358447-150358469 ACACCATTGCACTCCAGCGGGGG - Intergenic
914749571 1:150525242-150525264 GCACCATTGCACTCCAGTCTGGG + Intergenic
914770968 1:150684708-150684730 GCACCATTGCACTACAGTCTGGG - Intronic
914775809 1:150734069-150734091 GCACCATTGCACTCCAGTCTGGG - Intronic
915125482 1:153660603-153660625 GCACCATTGCACTTCAGCCTGGG + Intronic
915203632 1:154252600-154252622 GCACCATTGCACTTCAGCCTGGG - Intronic
916139227 1:161679445-161679467 GCACCATTGCACTTCAGCCTGGG + Intergenic
916301979 1:163285488-163285510 GCACCATTGCACTCCAGTCTGGG + Intronic
916667536 1:166980057-166980079 GCACCATTGCAGTCCAGTCTGGG - Intronic
916742464 1:167658466-167658488 GCACCATTGCACTCCAGTCTGGG - Intronic
917241938 1:172957930-172957952 GCACCACTGCACTTCAGTCTGGG + Intergenic
917345887 1:174027776-174027798 GCACCATTGCACTTCAGCCTGGG + Intergenic
917560732 1:176152215-176152237 GCACCATTGCAGTCCAGTCTGGG + Intronic
917816356 1:178713624-178713646 TCACCTTTGCAGGTCAGGGGAGG + Intergenic
917853403 1:179083433-179083455 GCACCACTGCACTCCAGTGTGGG - Intronic
917855605 1:179096780-179096802 GCACCATTGCACTTCAGCCTGGG + Intronic
918034846 1:180858170-180858192 GCACCATTGCACTCCAGTGTGGG + Intronic
918088284 1:181263888-181263910 GCACCAGCGCAGTTCCCTGGAGG + Intergenic
918088967 1:181271286-181271308 GCACCATTGCATTTCAGCCTGGG + Intergenic
918306055 1:183247267-183247289 GCGCCATTGCACTCCAGTGTGGG + Intergenic
918451416 1:184663139-184663161 GCACCATTGCACTCCAGTCTGGG - Intergenic
918652506 1:186983039-186983061 GCACCATTGCACTTCAGCCTGGG + Intronic
918696687 1:187553798-187553820 GCACCACTGCACTTCAGTCTGGG - Intergenic
918854449 1:189732698-189732720 GCACCATTGCACTCCAGTCTGGG + Intergenic
918950149 1:191126169-191126191 GCACCCATGCTGTGCAGTGGTGG - Intergenic
919100005 1:193083786-193083808 GCACCATTGCACTCCAGTGATGG - Intronic
919250217 1:195045885-195045907 GCACCATTGCACTTCAGCCAGGG - Intergenic
919345780 1:196376424-196376446 GCTTCATGGCAGTTCAGTGCAGG + Intronic
919452944 1:197791887-197791909 GCACCATTGCACTCCAGTCTAGG + Intergenic
919706592 1:200682171-200682193 GCACCACTGCACTTCAGTCTGGG - Intergenic
919822422 1:201481652-201481674 GCACCATTGCACTCCAGCGTGGG + Intergenic
919908638 1:202096135-202096157 GCACCATTGCAGTCCAGCCTGGG - Intergenic
920149466 1:203892835-203892857 GCACCATTGCACTCCAGTCTAGG + Intergenic
920220876 1:204399512-204399534 GCACCATTGCACTCCAGTCTGGG + Intergenic
920578824 1:207085490-207085512 GCACCACTGCACTCCAGTGTAGG - Intronic
920723022 1:208405907-208405929 GCACCACTGCACTCCAGTGTGGG + Intergenic
921067875 1:211635432-211635454 GCACCATTGCACTCCAGTCTGGG - Intergenic
921090636 1:211838820-211838842 GCACCACTGCAGTTCAGCCTGGG + Intergenic
921099291 1:211914599-211914621 GCACCATTGCACTCCAGTCTGGG - Intergenic
921136336 1:212262834-212262856 GCACCATTGCACTTCAGCCTGGG - Intergenic
921146050 1:212357837-212357859 GCACCATTGCACTCCAGTCTGGG - Intronic
921228965 1:213049859-213049881 GCACCATTGCACTTCAGCCTGGG - Intergenic
921365298 1:214368249-214368271 GCATCATTGCACTTCAGTCTGGG - Intronic
921542236 1:216430339-216430361 GCACCATTGCACTTCAGCCTGGG + Intergenic
922142024 1:222896556-222896578 GCACCATTGCACTTCAGCCTGGG + Intronic
922159862 1:223071472-223071494 GCACCACTGCACTTCAGCTGGGG + Intergenic
922235504 1:223719494-223719516 GCACCACTGCACTTCAGCCGGGG + Intronic
922251684 1:223854806-223854828 GCACCATTGCACTCCAGTCTGGG + Intergenic
922429986 1:225541922-225541944 TCACCATTGCACTTCAGTCTGGG - Intronic
922525417 1:226298847-226298869 GCACCACTGCACTTCAGTCTGGG + Intronic
922617250 1:226968290-226968312 GCGCCACTGCACTCCAGTGGGGG + Intronic
923417991 1:233783768-233783790 GCACCATTGCACTCCAGTCTGGG + Intergenic
923652749 1:235889257-235889279 GCACCATTGCACTTCAGCCTGGG + Intergenic
923922893 1:238588828-238588850 GCACCATTGCACTTCAGCCTGGG - Intergenic
924142370 1:241038922-241038944 GCACCATTGCACTTCAGCCTGGG + Intronic
924178813 1:241420523-241420545 GCACCACTGCACTCCAGTTGGGG - Intergenic
924307066 1:242700541-242700563 GCACCATTGCACTTCAGCCTGGG + Intergenic
924564805 1:245188235-245188257 GCACCATTGCACTCCAGTCTGGG + Intronic
924657419 1:245985532-245985554 GCACAATCACAGTTCAGAGGTGG + Intronic
924804399 1:247350811-247350833 GCACCACTGCACTCCAGTGTGGG + Intergenic
924828348 1:247565313-247565335 GCACCATTGCACTCCAGTCTGGG + Intronic
1062993319 10:1841108-1841130 GCACCATTGCACTCCAGTCTGGG + Intergenic
1063065230 10:2601362-2601384 GCACCATTGCACTCCAGTCTGGG - Intergenic
1063376831 10:5559095-5559117 GCACCATTGCACTCCAGCTGGGG - Intergenic
1063417355 10:5884687-5884709 GCACCATTGCAGTCCAGCCTGGG + Intronic
1063453322 10:6165855-6165877 GCACCACTGCACTTCAGTCTGGG - Intronic
1064024312 10:11834690-11834712 GCACCATTGCACTCCAGTCTGGG + Intronic
1064137629 10:12764336-12764358 GCACCATTGCACTCCAGTCTGGG + Intronic
1064189444 10:13192926-13192948 GCAGCATTGCACTTCAGCTGGGG - Intronic
1064268044 10:13840743-13840765 GCACCACTGCACTCCAGTGTGGG + Intronic
1064282951 10:13968000-13968022 ACACCACTGCACTTCAGCGGGGG + Intronic
1064430561 10:15266824-15266846 GCACCACTGCAGTTCAGCCTGGG + Intronic
1064836048 10:19532295-19532317 GCACCACTGCACTTCAGTCGGGG - Intronic
1064882568 10:20072325-20072347 GCACCATTGCACTTCAGCCTGGG + Intronic
1065211191 10:23405057-23405079 GCACCACTGCATTCCAGTGTGGG - Intergenic
1065320402 10:24503727-24503749 ACACAATTGCAGTTCAGAGGGGG + Intronic
1065348049 10:24767839-24767861 GCACAATTGTAGTTCACTGCAGG + Intergenic
1065351644 10:24800836-24800858 GCACCATTGCACTTCAGCCTGGG + Intergenic
1065569799 10:27058955-27058977 GCACCACTGCACTCCAGTGTGGG - Intronic
1065909522 10:30289553-30289575 GCACCATTGCACTCCAGTCTGGG + Intergenic
1066120830 10:32285519-32285541 GCACCATTGCACTCCAGTCTGGG - Intronic
1066273101 10:33842753-33842775 GCACCACTGCACTCCAGTGTGGG + Intergenic
1066292512 10:34027211-34027233 GCACCACTGCACTTCAGTCTGGG - Intergenic
1066549821 10:36544238-36544260 GCACCATTGCACTCCAGTCTGGG + Intergenic
1066691823 10:38036393-38036415 GCACCATTGCACTTCAGCCTGGG + Intronic
1066727230 10:38406546-38406568 GCACCATTGCACTCCAGCGTGGG - Intergenic
1067171273 10:43908314-43908336 GCACCACTGCACTTCAGTTTGGG - Intergenic
1067203820 10:44197066-44197088 GCACCATTGCACTTCAGCCTGGG - Intergenic
1067879520 10:50031331-50031353 ACACCATTGCACTCCAGTCGGGG - Intergenic
1067975107 10:51015842-51015864 GCGCCATTGCAGTTCAGCCTGGG + Intronic
1068109208 10:52659432-52659454 GCACCATTGCATTTCAGCCTGGG - Intergenic
1068118983 10:52766406-52766428 GCACCACCCTAGTTCAGTGGAGG + Exonic
1068183001 10:53546405-53546427 ACACCATTGCACTCCAGTGTGGG + Intergenic
1068534629 10:58228574-58228596 GCACCACTGCACTCCAGTGTAGG - Intronic
1068635314 10:59341644-59341666 GCACCATTGCACTTCAGCCTCGG + Intronic
1068667049 10:59687915-59687937 GCACCACTGCACTCCAGTGTGGG + Intronic
1068706756 10:60085656-60085678 GCACCATTGCACTCCAGTCTTGG - Intronic
1068981789 10:63070334-63070356 GCACCATTGCACTCCAGTCTGGG + Intergenic
1068985271 10:63102338-63102360 GCACCATTGCACTTCAGCCTGGG + Intergenic
1068999681 10:63249271-63249293 GCACCATTGCACTTCAGCCTGGG + Intronic
1069102068 10:64334506-64334528 GCACCTTTACAGTTCAGTCTAGG + Intergenic
1069379807 10:67831143-67831165 GCACCATTGCACTCCAGTCTGGG + Intronic
1069455430 10:68550176-68550198 GCACCACTGCACTCCAGTGTGGG + Intergenic
1069485976 10:68823756-68823778 GCACCATTGCACTCCAGTCTGGG + Intergenic
1069896610 10:71684036-71684058 GCACCATTGCACTTCAGCCTGGG + Intronic
1070126188 10:73624238-73624260 GCACCATTGCACTCCAGTCTGGG - Intronic
1070248320 10:74752267-74752289 GCACCATTGCACTTCAGCCTGGG - Intergenic
1070621200 10:78012762-78012784 GCACCACTGCAGTTCAGCCTGGG - Intronic
1071577779 10:86742128-86742150 GCACCATTGCAGTTCAGCATGGG + Intergenic
1071617108 10:87085301-87085323 GCACCATTGCACTTCAGCCTGGG + Intronic
1071931273 10:90473845-90473867 GCACCACTGCATTCCAGTGTGGG - Intergenic
1072042216 10:91618875-91618897 GCACCACTGCACTCCAGTGTGGG - Intergenic
1072072008 10:91927179-91927201 GCACCATTGCACTCCAGCGTGGG - Intronic
1072172085 10:92874008-92874030 GCACCATTGCACTTCAGCCTAGG + Intronic
1072455988 10:95576156-95576178 GCACCATTGCACTCCAGTCTGGG + Intergenic
1072630659 10:97144153-97144175 GCACCATTGCACTCCAGTCTAGG + Intronic
1072672092 10:97437960-97437982 GCACCACTGCACTCCAGTGTGGG - Intronic
1072944260 10:99795654-99795676 GCACCATTGCACTCCAGTCTGGG + Intronic
1073045477 10:100635288-100635310 GCACCATTGCACTCCAGTCTAGG + Intergenic
1073413984 10:103366290-103366312 GCACCATTGCACTTCAGCCTGGG - Intergenic
1073701818 10:105935584-105935606 GCACCATTGCACTCCAGCTGGGG - Intergenic
1073977098 10:109114488-109114510 GCACCATTGCACTTCAGCCTGGG + Intergenic
1074824323 10:117203580-117203602 GCACCATTGCACTCCAGTCTGGG - Intronic
1074999580 10:118785585-118785607 GCACCACTGCACTCCAGTGTGGG + Intergenic
1075153702 10:119956819-119956841 GCACCACTGCACTCCAGTGCAGG + Intergenic
1075228204 10:120648773-120648795 GCACCATTGCACTTCAGCCTGGG + Intergenic
1075363707 10:121863650-121863672 GCACCACTGCAGTTCAGCCTGGG - Intronic
1075493210 10:122893098-122893120 GCACCATTGCACTCCAGTCTGGG - Intergenic
1075566195 10:123506162-123506184 GCACCATTGCACTTCAGCCTGGG + Intergenic
1075597773 10:123744539-123744561 CCACCTTTGCAGTTCAGAAGGGG - Intronic
1075764410 10:124881023-124881045 GCACCATTGCGCTTCAGTCTGGG + Intergenic
1076007535 10:126959858-126959880 GCACCATTGCACTCCAGTCTGGG - Intronic
1076201016 10:128558029-128558051 GCACCATTGCACTTCAGCTTGGG - Intergenic
1077064072 11:631401-631423 GCACCATTGCACTCCAGTCTGGG - Intergenic
1077206653 11:1347899-1347921 GCACCATTGCACTCCAGTCTGGG + Intergenic
1077277934 11:1725298-1725320 GCGCCACTGCACTCCAGTGGGGG + Intergenic
1077629469 11:3801089-3801111 GCACCATTGCACTCCAGCGTGGG + Intronic
1078040413 11:7856497-7856519 TCACCATTCCAGATCAGTGAGGG + Intergenic
1078173678 11:8951713-8951735 GCACCACTGCAGTCCAGCCGGGG + Intronic
1078223360 11:9370110-9370132 GCACCATTGCACTCCAGTCTGGG + Intergenic
1078233471 11:9462830-9462852 GCACCATTGCACTCCAGTCTGGG + Intronic
1078604570 11:12763885-12763907 CCACCATTGCATTTCTGTGTGGG + Intronic
1079046922 11:17113052-17113074 GCACCATTGCAGTCCAGCCTGGG - Intronic
1079061500 11:17252631-17252653 GCACCACTGCACTCCAGTGTGGG + Intronic
1079556257 11:21761457-21761479 GCACCATTGCACTCCAGTCTGGG - Intergenic
1079704438 11:23596675-23596697 GCACCATTGCATTTCAGTCTGGG - Intergenic
1080068845 11:28054251-28054273 GCACCATTGCACTTCAGCCTAGG - Intronic
1080079170 11:28194239-28194261 GCACCATTGCACTTCAGCATGGG - Intronic
1080219014 11:29878812-29878834 GCACCATTGCACTCCAGTCTAGG + Intergenic
1080651632 11:34227229-34227251 GCACCACTGCACTCCAGTGTGGG + Intronic
1080993143 11:37565731-37565753 GCACCATTGCAGTCCATTCTGGG + Intergenic
1081075275 11:38665956-38665978 GCACCATTGCACTCCAGTCTGGG - Intergenic
1081319673 11:41675761-41675783 GCACCAGTGCAGTTCAGCCTGGG + Intergenic
1081542142 11:44043038-44043060 GCACCATTGCACTCCAGTCTCGG + Intergenic
1081852656 11:46284609-46284631 GCACCATTGCACTCCAGTCTGGG + Intronic
1081855815 11:46302936-46302958 GCACCACTGCACTCCAGCGGAGG + Intronic
1081873722 11:46394959-46394981 GCACCATTGCACTCCAGTCTGGG + Intergenic
1082005493 11:47416752-47416774 GCACCACTGCACTCCAGTGTGGG - Intergenic
1082047086 11:47738520-47738542 GCACCATTGCAGTCCAGTCTGGG + Intronic
1082780639 11:57284945-57284967 GCACCATTGCACTCCAGTCTGGG - Intergenic
1082828915 11:57600906-57600928 GCACCATTGCACTACAGTCTGGG + Intronic
1082831287 11:57619633-57619655 GCACCATTGCACTCCAGTCTGGG - Intergenic
1082943034 11:58728103-58728125 GCACCACTGCACTCCAGTGTGGG - Intronic
1083030029 11:59583986-59584008 GCACCATTGCATTCCAGTCTGGG - Intronic
1083212541 11:61197046-61197068 GCACCATTTCACTTCAGTCTGGG + Intergenic
1083215491 11:61216204-61216226 GCACCATTGCACTTCAGCCTGGG + Intergenic
1083218375 11:61235033-61235055 GCACCATTGCACTTCAGCCTGGG + Intergenic
1083314839 11:61808291-61808313 GCACCATTGCACTTCAGCCTGGG + Intronic
1083369041 11:62163980-62164002 GCACCATTGCACTCCAGTCTGGG - Intergenic
1083544137 11:63536483-63536505 GCACCATTGCACTCCAGTCTGGG + Intergenic
1083835952 11:65267832-65267854 GCACCATTGCACTTCAGCCTGGG - Intronic
1084027624 11:66462074-66462096 GCACCATTGCACTTCAGCCTGGG + Intronic
1084034823 11:66503009-66503031 GCACCATTGCACTCCAGCGTGGG - Intronic
1084042379 11:66549686-66549708 GCACCATTGCACTCCAGTCTGGG + Intronic
1084140644 11:67226020-67226042 GCACCATTGCAGTCCAGCCTGGG + Intronic
1084142698 11:67243770-67243792 GCACCATTGCACTTCAGCCTGGG + Intronic
1084328544 11:68416010-68416032 GCACCACTGCAGTCCAGCGTGGG + Intronic
1084391514 11:68880361-68880383 GCACCATTGCACTCCAGTCTGGG - Intergenic
1084469309 11:69346796-69346818 GTGCCATGGCAATTCAGTGGAGG - Intronic
1084753255 11:71218305-71218327 GCACCATTGCACTCCAGCGTGGG - Intronic
1084920575 11:72466186-72466208 GCACCATTGCACTCCAGCCGGGG + Intergenic
1085094898 11:73752411-73752433 GCACCATTGCACTCCAGCCGGGG + Intronic
1085102954 11:73816866-73816888 GCACCACTGCACTCCAGTGTGGG - Intronic
1085355335 11:75831443-75831465 GCACCATTGCACTACAGTCTGGG + Intronic
1085539376 11:77252968-77252990 GCACCATGGCAGTTGATTGTAGG - Intronic
1085792279 11:79506539-79506561 GCACCATTGCACTCCAGCCGGGG - Intergenic
1086248455 11:84784275-84784297 GCACCATTGCATTTCAGCCTGGG + Intronic
1086665191 11:89471782-89471804 GCACCATTGCACTCCAGTCTGGG - Intronic
1086787879 11:90994979-90995001 GCACCACTGCACTTCAGTCTGGG - Intergenic
1087216830 11:95503786-95503808 GCACCATTGCACTCCAGTCTGGG + Intergenic
1087253631 11:95930911-95930933 GCACCATTGCACTTCAGCCTGGG + Intergenic
1087440714 11:98179720-98179742 GCACCATTGCACTTCAGCCTGGG + Intergenic
1087663975 11:101021005-101021027 GCACAATTGCACTTCAATGCCGG - Intergenic
1087749004 11:101985323-101985345 GCACCATTGCACTTCAGCCTAGG - Intronic
1087758516 11:102080458-102080480 GCACCATTGCACTCCAGTCTGGG - Intronic
1088357261 11:108957109-108957131 GCACCATTGCACTTCAGCCTGGG + Intergenic
1088414962 11:109578547-109578569 GCACCATTGCACTTCAGCCTGGG - Intergenic
1088483099 11:110314775-110314797 GCACCATTGCACTCCAGTCTGGG - Intergenic
1088770657 11:113032538-113032560 GCTCCCTTGCAGGTAAGTGGGGG - Intronic
1088928983 11:114329916-114329938 GCACCATTGCACTCCAGTCTGGG + Intergenic
1089089273 11:115854395-115854417 GCACCATTGCACTCCAGTCTGGG + Intergenic
1089240131 11:117070793-117070815 GCACCATTGTACTCCAGTGTGGG - Intronic
1089757554 11:120697570-120697592 GCACCATTGCACTCCAGTCTGGG + Intronic
1089774197 11:120824965-120824987 GCACCATTGCACTTCAGCCTGGG - Intronic
1089825546 11:121272674-121272696 GCACCATTGCACTCCAGTCTGGG + Intergenic
1089906936 11:122049534-122049556 GCGCCATTGCACTCCAGTGTGGG + Intergenic
1090069540 11:123531776-123531798 GCACCATTGCACTTCAGTCTGGG - Intronic
1090069691 11:123533010-123533032 GCACCATTGCACTTCAGCCTGGG - Intronic
1090283012 11:125474065-125474087 GCACCATTGCACTCCAGTCTGGG - Intronic
1090296199 11:125590862-125590884 GCGCCATTGCACTTCAGTCTGGG - Intergenic
1090462156 11:126901169-126901191 GCACCATTGCATTTCAGCCTGGG + Intronic
1091345864 11:134853541-134853563 GCACCATTGCACTTCAGCCTGGG + Intergenic
1091469914 12:717731-717753 ACACCATTGCACTTCAGTCTGGG - Intergenic
1091546400 12:1503971-1503993 GCACCATTGCACTTCAGCCTGGG - Intergenic
1091556748 12:1579568-1579590 GCACCATTGCACTCCAGTCTCGG + Intronic
1092108157 12:5938780-5938802 GCACCATTGCACTTCAGCCTGGG + Intronic
1092240830 12:6835539-6835561 GCACCATTGCAGTCCAGCCTGGG + Intronic
1092353428 12:7774858-7774880 GCACCATTGCACTCCAGTCTGGG - Intergenic
1092357641 12:7809901-7809923 GCACCATTGCACTCCAGTCTGGG - Intergenic
1092369319 12:7903390-7903412 GCACCATTGCACTCCAGTTTGGG + Intergenic
1092484192 12:8887909-8887931 GCACCATTGCACTCCAGCGTGGG - Intergenic
1092492804 12:8961453-8961475 GCACCATTGCACTCCAGTCTGGG - Intronic
1092494494 12:8979055-8979077 GCACCATTGCACTCCAGTCTGGG - Intronic
1092499212 12:9029256-9029278 GCACCATTGCACTCCAGTCTGGG - Intergenic
1092801321 12:12170287-12170309 GCACCACTGCACTTCAGTCTGGG + Intronic
1092813974 12:12296810-12296832 GCACCACTGCACTCCAGTGTGGG + Intergenic
1092838478 12:12515368-12515390 GCACCATTGCACTTCAGCCTGGG - Intronic
1092874467 12:12836083-12836105 GCACCATTGCACTTCAGCCTGGG - Intergenic
1093030940 12:14287878-14287900 GCACCATTGCACTCCAGTCTGGG + Intergenic
1093111013 12:15152099-15152121 GTACCATTGCTGTTCAGTGAAGG + Intronic
1093456794 12:19372814-19372836 TCACCATTGCACTCCAGTGTGGG - Intronic
1093647148 12:21600160-21600182 GCACCATTGCACTCCAGCCGGGG - Intronic
1093955858 12:25217849-25217871 GCACCACTGCACTTCAGTCTGGG + Intronic
1094115762 12:26910876-26910898 GCACCATTGCACTTCAGCCTGGG - Intronic
1094133194 12:27097176-27097198 GCACCATTGCACTTCAGCCTGGG - Intergenic
1094183014 12:27612374-27612396 GCACCATTGCACTTCAGCCTGGG - Intronic
1094367870 12:29703099-29703121 GCTCCATTGCAGTCCAGTCTGGG + Intronic
1094424883 12:30307050-30307072 GCACCATTGCACTTCAGCCTGGG + Intergenic
1094543267 12:31380132-31380154 GCACCATTGCACTTCAGACTGGG - Intergenic
1094580025 12:31726202-31726224 GCACCATTGCACTCCAGTTTGGG - Intronic
1095044390 12:37484918-37484940 ACACCATTGCACTTCAGTCTGGG - Intergenic
1095052872 12:37569695-37569717 GCACCACTGCAGTTCAGCCTGGG - Intergenic
1095670953 12:44859496-44859518 GCACCATTGCACTCCAGTCTGGG + Intronic
1095929199 12:47608947-47608969 GCACCATTGCACTTCAGCCTGGG - Intergenic
1096090814 12:48899476-48899498 GCACCATTGCACTTCAGCCTGGG + Intergenic
1096146186 12:49280623-49280645 GCACCATTGCACTCCAGTCTGGG + Intergenic
1096206616 12:49727784-49727806 GCACCATTGCACTTCAGCCTTGG + Intronic
1096296503 12:50388574-50388596 GCACCATTGCACTCCAGTGTGGG + Intronic
1096367163 12:51037861-51037883 GCACCATTGCAGTCCAGCTTAGG + Intergenic
1096620728 12:52863079-52863101 GCACCATTGCACTCCAGTCTGGG + Intergenic
1096641597 12:52998878-52998900 GCACCATTGCACTTCAGCCTGGG + Intergenic
1096688288 12:53303588-53303610 GCACCACTGTAGTTCACTAGTGG + Intronic
1096700763 12:53380992-53381014 GCACCATTGCATTCCAGTCTGGG - Intronic
1097111852 12:56665682-56665704 ACACCATTGCACTCCAGTGTGGG - Intronic
1097207797 12:57338258-57338280 GCACCATTGCACTCCAGTCTGGG + Intronic
1097211457 12:57373768-57373790 GCACCATTGCACTCCAGTCTGGG + Intronic
1097384482 12:58933485-58933507 CCACCATGGCAGTTCCCTGGTGG - Intergenic
1097420808 12:59376867-59376889 GCACCATTGCACTTCAGCCTGGG - Intergenic
1097718303 12:62992300-62992322 GCACCATTGCACTTCAGCTTGGG - Intergenic
1098230599 12:68368925-68368947 GCACCATTGCACTCCAGTCTGGG - Intergenic
1098284340 12:68892798-68892820 GCACCATTGCACTTCAGCCTGGG + Intronic
1098393389 12:69992783-69992805 GCACCATTGCACTCCAGTCCGGG + Intergenic
1098689430 12:73467589-73467611 GCACCATTGCATTCTAGTGGGGG + Intergenic
1098693332 12:73518576-73518598 GCACCATTGCACTCCAGTCTGGG + Intergenic
1098719609 12:73880358-73880380 GCACCATTGCACTCCAGTCTGGG - Intergenic
1099028663 12:77497145-77497167 GCACCATTGCACTTCAGCCTGGG - Intergenic
1099794146 12:87376127-87376149 GCACCACTGCATTTCAGTCTGGG - Intergenic
1099888787 12:88563917-88563939 GCACCATTGCACTCCAGCAGGGG + Intronic
1100011330 12:89957059-89957081 GCACCATTGCATTCCAGTCTAGG - Intergenic
1100254195 12:92865786-92865808 GCACCATTGCACTTCAGCCTGGG - Intronic
1100258018 12:92904003-92904025 GCACCATTGCACTCCAGTCTGGG - Intronic
1100316170 12:93446739-93446761 GCACCACTGCACTTCAGTCTGGG - Intergenic
1100489865 12:95068749-95068771 GCACCATTGCACTCCAGTCTGGG + Intronic
1100544447 12:95587949-95587971 GCACCATTGCACTTCAGCCTGGG + Intergenic
1100571432 12:95846690-95846712 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1100605873 12:96151583-96151605 ACACCATTGCACTTCAGTCTGGG + Intergenic
1100825065 12:98467454-98467476 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1100915597 12:99417309-99417331 GTACAAAAGCAGTTCAGTGGAGG - Intronic
1100964733 12:100000151-100000173 ACACCATTGCACTCCAGTGTTGG - Intergenic
1101010798 12:100447043-100447065 GCACCATTGCACTTCAGCCTAGG + Intergenic
1101105848 12:101439060-101439082 GCACCATTGCACTCCAGTATGGG + Intergenic
1101108377 12:101461820-101461842 GCACCATTGCACTTCAGCCCGGG - Intergenic
1101491300 12:105212074-105212096 GCACCACTGCAGTTCAGCCTGGG + Intronic
1101687296 12:107037487-107037509 ACACCATTGCACTCCAGTGTGGG + Intronic
1101757063 12:107629378-107629400 GCACCATTGCACTTCAGCCTGGG + Intronic
1101887860 12:108683374-108683396 GCACCATTGCACTCCAGTCCGGG + Intronic
1102045088 12:109824711-109824733 GCACCACTGCACTCCAGCGGGGG + Intronic
1102064928 12:109966464-109966486 GCACCATTGCACTCCAGTCTGGG + Intronic
1102080953 12:110097730-110097752 GCACCATTGCACTCCAGTCTGGG - Intergenic
1102146297 12:110657450-110657472 GCACCATTGCAGTCCAGCTTGGG + Intronic
1102355302 12:112229282-112229304 GCACCATTGCACTTCAGCCTGGG + Intronic
1102428345 12:112862195-112862217 GTACCATTGCACTTCAGTCTGGG + Intronic
1102538083 12:113596811-113596833 GCACCATTGCACTTCAGCCTGGG - Intergenic
1102696076 12:114800519-114800541 GTACCATTGCATTTCAGTCTGGG - Intergenic
1103004636 12:117411265-117411287 GCACCATTGAACTCCAGTGTGGG - Intronic
1103037828 12:117670807-117670829 GCAGCTTTGCCGTTCCGTGGGGG - Intronic
1103262967 12:119604676-119604698 GCACCATTGCACTCCAGTCTGGG - Intronic
1103275537 12:119708526-119708548 GTACCATTGCACTCCAGTGTGGG - Intronic
1103314321 12:120040143-120040165 GCACCACTGCACTCCAGTGTGGG - Intronic
1103350739 12:120281838-120281860 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1103385436 12:120528759-120528781 GGACCATTGCACTCCAGTGTGGG + Intronic
1103467609 12:121154245-121154267 GCACCATTGCACTCCAGTCTGGG + Intronic
1103497388 12:121373561-121373583 GCACCATTGCACTCCAGTCTAGG + Intronic
1103513721 12:121492936-121492958 GCACCACTGCACTTCAGTCTGGG - Intronic
1103651108 12:122433355-122433377 GCACCATTGCACTCCAGTCTGGG - Intergenic
1103726949 12:123002291-123002313 GCACCACTGCAGTTCAGCCTGGG + Intronic
1104176369 12:126336541-126336563 GGTCCATGGCAGTTCAGTGAGGG + Intergenic
1104977638 12:132559432-132559454 GCACCACTGCACTTCAGCGTAGG - Intronic
1105230727 13:18493003-18493025 GCACCATTGCACTCCAGTCTGGG - Intergenic
1105334769 13:19457049-19457071 GCACCTCTGCAATTCATTGGGGG + Intronic
1105383213 13:19906230-19906252 GCACCATTGCACTCCAGTCTGGG + Intergenic
1105384779 13:19919718-19919740 GCACCATTGCACTTCAGCCTGGG - Intergenic
1105939982 13:25139551-25139573 GCACCATTGCACTTCAGCCTGGG - Intergenic
1105945640 13:25187283-25187305 GCACCATTGCACTCCAGTCTGGG - Intergenic
1105951723 13:25235243-25235265 GCACCATTGCATTCCAGTCTGGG - Intergenic
1105965248 13:25377747-25377769 GCACCATTGCACTCCAGTCTGGG + Intronic
1106223383 13:27766247-27766269 GCACCATTGCACTTCAGTATGGG - Intergenic
1106333228 13:28759488-28759510 GCACCATTGCACTTCAGCCTGGG - Intergenic
1106339575 13:28816037-28816059 GCACCACTGCACTTCAGTCTGGG + Intergenic
1106456132 13:29928872-29928894 GCACCATTGCACTCCAGTCTGGG + Intergenic
1106637433 13:31543909-31543931 GCACCACTGCACTCCAGCGGGGG + Intergenic
1107003130 13:35574790-35574812 GCACCATTGCACTTCAGCCTGGG - Intronic
1107006086 13:35613661-35613683 GCACCACTGCACTTCAGTCTGGG - Intronic
1107152311 13:37125951-37125973 GCGCCATTGCACTTCAGTCTGGG + Intergenic
1107278764 13:38708800-38708822 GCACCATTGCATTCCAGCGTGGG - Intronic
1107318645 13:39161695-39161717 GCACCATTGCATTCCAGTGTGGG + Intergenic
1107344252 13:39441870-39441892 GCACCATTGCACTCCAGTCCAGG - Intronic
1107653115 13:42564522-42564544 GCACCATTGCACTTCAGCCTGGG + Intronic
1107798172 13:44076319-44076341 GCACCATTGCACTCCAGTCTGGG + Intergenic
1107881105 13:44832794-44832816 GCACCATTGCACTTCAGCCTGGG - Intergenic
1108343437 13:49520088-49520110 GCACCATTGCAGTCCAGCCTGGG - Intronic
1108646459 13:52434399-52434421 GCACCATTGCACTTCAGCCTGGG - Intronic
1108665733 13:52628916-52628938 GCACCATTGCAGTCCAGCCGAGG - Intergenic
1108713469 13:53056753-53056775 GCACCACTGCACTTCAGTCTGGG - Intergenic
1108921717 13:55683244-55683266 GCACCATTGCACTCCAGTCTGGG - Intergenic
1108956805 13:56167999-56168021 GCACCATTGCACTCCAGTCTGGG + Intergenic
1108983249 13:56547492-56547514 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1110261997 13:73495828-73495850 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1110292643 13:73825024-73825046 GCACCATTGCATTCCAGTCTGGG + Intronic
1110407621 13:75168466-75168488 GCACCATTGCACTTCAGCCTGGG - Intergenic
1110749515 13:79096528-79096550 GCACCATTGCACTTCAGCCTGGG - Intergenic
1111112985 13:83739710-83739732 GCACCATTGCACTTCAGCCTGGG - Intergenic
1111745031 13:92257591-92257613 GCACCATTGCACTCCAGTCTGGG - Intronic
1111968355 13:94883840-94883862 GCACCATTGCACTCCAGTCTGGG + Intergenic
1112039432 13:95531571-95531593 GCACCACTGCACTTCAGTCTGGG - Intronic
1112210637 13:97374115-97374137 GCACCATTGCACTCCAGCGTAGG - Intronic
1112529366 13:100185688-100185710 GCACCATTGCACTCCAGCGTGGG - Intronic
1112557566 13:100482629-100482651 GCACCATTGCATTTCAGCTTGGG - Intronic
1112738316 13:102445463-102445485 GCACCATTGCACTCCAGTCTGGG + Intergenic
1113112704 13:106841276-106841298 GCACCATTGCACTTCAGCCTGGG - Intergenic
1113259316 13:108544020-108544042 GCACCATTGCACTCCAGTCTGGG + Intergenic
1113474050 13:110567353-110567375 GCACCATTGCACTTCAGCCTGGG + Intergenic
1113818396 13:113192209-113192231 GCACCATTGCACTTCAGCTTGGG + Intronic
1113978170 13:114247831-114247853 GCACCATTGCACTCCAGTCTGGG + Intronic
1114006407 14:18318725-18318747 GCACCACTGCATTTCAGTCTGGG - Intergenic
1114367305 14:22043235-22043257 ACACCACTGCAATTCAGTGGGGG - Intergenic
1114440677 14:22744723-22744745 GCACCATTACACTTCAGTCTGGG - Intergenic
1114472178 14:22970775-22970797 GCACCATTGCACTTCAGCCTGGG + Intronic
1114585749 14:23812086-23812108 GCACCACTGCACTCCAGTGCAGG - Intergenic
1114797677 14:25735044-25735066 GCACCATTGCACTCCAGTCTGGG + Intergenic
1114879634 14:26768466-26768488 GCACCATTGCACTCCAGTCTGGG + Intergenic
1114933800 14:27507633-27507655 GCACCATTGCACTCCAGCGTGGG - Intergenic
1115548064 14:34480745-34480767 GCACCATTGCACTCCAGTCTGGG + Intergenic
1115601104 14:34956649-34956671 GCGCCATTGCACTTCAGCGTGGG + Intergenic
1115673236 14:35639894-35639916 GCACCACTGCAGTTCAGCCTGGG + Intronic
1116001644 14:39249181-39249203 GCACCACTGCACTCCAGTGTAGG - Intronic
1116229610 14:42199563-42199585 GCACCATTGCACTCCAGTCTGGG + Intergenic
1116445477 14:45004963-45004985 GCACCATTGCACTCCAGTCTGGG - Intronic
1116445714 14:45008279-45008301 GCACCATTGCACTCCAGTCTAGG - Intronic
1116814415 14:49570193-49570215 GCACCATTGCACTCCAGTCTGGG + Intergenic
1116847376 14:49877731-49877753 GCACCATTGCACTTCAGCCTGGG - Intergenic
1117152348 14:52902348-52902370 GCACCATTGCACTTCAGCTTGGG + Intronic
1117441454 14:55763454-55763476 GCACCATTGCACTTCAGCCTGGG - Intergenic
1117651997 14:57917101-57917123 GCACCATTGCACTCCAGCGTGGG - Intronic
1117820188 14:59641001-59641023 GCACCACTGCACTTCAGTGTGGG - Intronic
1118029415 14:61805824-61805846 GCGCCACTGCAGTCCAGTGTGGG - Intergenic
1118157132 14:63253309-63253331 GCACCATTGCACTGCAGTCTGGG - Intronic
1118177995 14:63462111-63462133 GCACCACTGCACTTCAGCGTGGG - Intronic
1118180880 14:63491802-63491824 GCACCATTGCACTCCAGTCTGGG + Intronic
1118196854 14:63634825-63634847 GCACCATTGCACTGCAGTCTGGG + Intronic
1118343984 14:64921082-64921104 GCACCATTGTAATTCAGTGGGGG + Intronic
1118552628 14:66972223-66972245 GCACCATTGCACTCCAGCCGGGG + Intronic
1118564904 14:67128855-67128877 GCACCATTGCACTCCAGTGTGGG - Intronic
1118631784 14:67711960-67711982 GCACCATTGCACTTCAGCCTGGG - Intronic
1119237406 14:73031108-73031130 GCACCATTGCACTCCAGTCTGGG + Intergenic
1119354230 14:73991954-73991976 GCACCATTGCACTCCAGCGTGGG + Intronic
1119433258 14:74582060-74582082 GCACCATTGCACTCCAGCTGGGG - Intronic
1119455632 14:74753196-74753218 GCACCACTGCAGTCCAGTCTGGG - Intergenic
1119475689 14:74926313-74926335 GCACCATTGCACTCCAGTCTGGG - Intergenic
1119565528 14:75626032-75626054 GCACCACTGCACTCCAGTGTGGG - Intronic
1119682419 14:76602858-76602880 GCACCATTGCACTCCAGTCTGGG - Intergenic
1119715954 14:76859489-76859511 GCACCATTGCACTTCAGCCTGGG + Intronic
1119735619 14:76979911-76979933 GCACCATTGCACTCCAGTCTGGG - Intergenic
1119812748 14:77536963-77536985 GCACCATTGCACTCCAGTCTGGG - Intronic
1119837385 14:77762463-77762485 GCACCATTGCACTCCAGCGTGGG + Intronic
1120102374 14:80460424-80460446 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1120193522 14:81460625-81460647 GCACCATTGCACTTCAGCCTGGG - Intergenic
1120304585 14:82752454-82752476 GCACCATTGCACTCCAGCGTGGG + Intergenic
1120409907 14:84141362-84141384 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1120690270 14:87584900-87584922 GCACCATTGCACTCCAGTCTGGG + Intergenic
1120757255 14:88255815-88255837 GCACCACTGCACTCCAGTGTGGG + Intronic
1120768050 14:88349440-88349462 GCACCATTGCACTCCAGTCTGGG - Intergenic
1120782505 14:88498056-88498078 GCACCATTGCACTCCAGCGTGGG + Intronic
1120794665 14:88619320-88619342 GCACCATTGCACTTCAGCATGGG + Exonic
1120917669 14:89723870-89723892 GCACCATTGCACTCCAGTCTGGG + Intergenic
1120961600 14:90130240-90130262 GCACCATTGCACTCCAGTCTGGG - Intronic
1121133251 14:91469609-91469631 GCACCATTGCACTCCAGTCTGGG - Intronic
1121148065 14:91604069-91604091 GCACCATTGCAGTCCAGCCTGGG - Intronic
1121172297 14:91864822-91864844 GCACCATTGCATTTCAGCCTGGG - Intronic
1121200395 14:92112104-92112126 GCGCCATTGCACTTCAGTCTAGG + Intergenic
1121901194 14:97694745-97694767 GCACCATTGCATTTCAGCCTAGG + Intergenic
1122180990 14:99954384-99954406 GCACCACTGCACTCCAGTGTGGG + Intergenic
1122247057 14:100410823-100410845 GCACCACTGCACTCCAGTGTGGG - Intronic
1122420869 14:101576313-101576335 GCACCAGTGCACTTCAGTCTGGG + Intergenic
1122432570 14:101664875-101664897 GCACCATTGCACTCCAGTCTGGG - Intergenic
1122575881 14:102741441-102741463 GCACCATTGCACTCCAGCGTAGG + Intergenic
1123047118 14:105523861-105523883 GCACCACTGCACTCCAGTGTGGG - Intergenic
1123121064 14:105917353-105917375 GCTCCGTGGCTGTTCAGTGGTGG + Intergenic
1123168877 14:106352150-106352172 GCACCATTGCACTCCAGTCTGGG + Intergenic
1202908931 14_GL000194v1_random:99138-99160 GCACCATTGCACTACAGTCTCGG + Intergenic
1202884329 14_KI270722v1_random:90091-90113 GCACCATTGCACTACAGTCTGGG - Intergenic
1123390331 15:19865374-19865396 GCACCACTGCACTTCAGTCTGGG - Intergenic
1123494322 15:20810277-20810299 GCACCATTGCACTTCAGCCTGGG - Intergenic
1123550820 15:21379368-21379390 GCACCATTGCACTTCAGCCTGGG - Intergenic
1123633404 15:22277977-22277999 GCACCATTGCACTTCAGCCTGGG - Intergenic
1123683554 15:22781430-22781452 GCACCATTGCACTCCTGTGTGGG + Intronic
1123803412 15:23845617-23845639 GCACCATTGCACTCCAGTTTGGG + Intergenic
1123907123 15:24932275-24932297 GCACCATTGCACTTCAGCCTGGG - Intronic
1123993530 15:25702283-25702305 GAACCATTTCAGGACAGTGGTGG + Intronic
1124243348 15:28050240-28050262 GCACCATTGCACTCCAGTCTGGG + Intronic
1124575968 15:30908796-30908818 GCACCATTGCATTTCAGCCTGGG + Intronic
1125571634 15:40724543-40724565 GCACCATTGCATTCTAGTGGGGG - Intronic
1125595343 15:40881834-40881856 GCACCATTGCACTCCAGCGTGGG - Intergenic
1126356795 15:47804475-47804497 GCACCACTACACTTCAGTGTGGG + Intergenic
1126410542 15:48368779-48368801 GCACCATTGCACTCCAGTCTGGG + Intergenic
1126492398 15:49252221-49252243 GCACCATTGCACTCCAGTCTGGG + Intronic
1126633654 15:50761571-50761593 GCACCATTGCACTTCAGCCTGGG + Intronic
1127029506 15:54846022-54846044 GCACCATTGCACTTCAGCCTGGG + Intergenic
1127130585 15:55858347-55858369 GCACCATTGCACTTCAGCTTGGG - Intronic
1127165289 15:56239309-56239331 GCACCATTGCACTCCAGTCTGGG - Intronic
1127560303 15:60129727-60129749 GCACCATTGCATTCCAGTCTGGG - Intergenic
1127580832 15:60338090-60338112 GCACCATTGCACTTCAGCCTGGG - Intergenic
1127603762 15:60565293-60565315 GTACCATTGCTATTCAGTGTTGG + Intronic
1127712511 15:61613884-61613906 GCAACATTGCAGTTTTTTGGAGG + Intergenic
1127895783 15:63297485-63297507 GCACCATTGCACTCCAGTCTGGG + Intronic
1128093048 15:64931934-64931956 GCACCATTGCACTTCAGCCTGGG - Intronic
1128423400 15:67516540-67516562 GCACCATTGCACTCCAGTCTGGG - Intergenic
1128514352 15:68333140-68333162 GCACCATTGCACTCCAGTCTGGG - Intronic
1128573151 15:68750466-68750488 GCACCATTGCACTTCAGCCTGGG + Intergenic
1128772902 15:70295664-70295686 GCACCATTGCATTCCAGTCTGGG - Intergenic
1129047121 15:72745407-72745429 GCACCATTGCACATCAGTCTGGG + Intergenic
1129340144 15:74880542-74880564 GCACCATTGCACTCCAGCTGGGG - Intergenic
1129419558 15:75413153-75413175 GCACCATTGCAGTCCAGCCTGGG - Intronic
1129459247 15:75692022-75692044 GCACCATTGCACTTCAGCCTGGG - Intronic
1129533013 15:76284531-76284553 GCACCATTGCATTTCAGCCTGGG - Intronic
1129587705 15:76885524-76885546 GCACCATTGCACTCCAGTCTGGG - Intronic
1129755446 15:78095520-78095542 GCATCACTGCAATTCCGTGGGGG + Intronic
1129808602 15:78486710-78486732 GCACCACTGCACTCCAGTGTGGG - Intronic
1129830565 15:78667169-78667191 GCACCATTGCACTCCAGTCTGGG - Intronic
1129995367 15:80000163-80000185 CCACCACTGCAATTCAATGGTGG + Intergenic
1129995366 15:80000163-80000185 CCACCATTGAATTGCAGTGGTGG - Intergenic
1130058975 15:80555920-80555942 GCACCACTGCACTTCAGTCTGGG + Intronic
1130147337 15:81283958-81283980 GCACCATTGCACTTCAGCCTGGG + Intronic
1130434468 15:83883933-83883955 GCACCATTGCACTCCAGCCGGGG - Intronic
1130521499 15:84664784-84664806 GCACCACTGCACTCCAGTGTGGG - Intergenic
1130533720 15:84767917-84767939 GCACCATTGCACTCCAGGGTAGG - Intronic
1130561997 15:84966118-84966140 GCACCACTGCACTTCAGTGTGGG - Intergenic
1130646280 15:85729899-85729921 GCACCATTGCACTCCAGTCTGGG + Intronic
1131088358 15:89598403-89598425 GCACCATTGCACTCCAGTCTGGG - Intronic
1131102801 15:89706495-89706517 GCACCAAGGCAATTCAGTGGGGG + Intronic
1131269401 15:90937527-90937549 GCACCACTGCACTCCAGTGTGGG - Intronic
1131740730 15:95388240-95388262 GCACCACTGCATTTCAGCCGGGG - Intergenic
1131784042 15:95892025-95892047 GCACCACTGCACTTCAGTCTGGG + Intergenic
1132074473 15:98808720-98808742 GCACCACTGCACTCCAGTGTAGG - Intronic
1132154654 15:99486949-99486971 GCCCCATTTCTGTTCAGTAGTGG + Intergenic
1202959160 15_KI270727v1_random:106612-106634 GCACCATTGCACTTCAGCCTGGG - Intergenic
1132506629 16:313257-313279 GCACCATTGCAGTCCAGCCTGGG + Intronic
1132548144 16:543006-543028 GCACCACTGCACTCCAGTGTGGG + Intronic
1132660527 16:1059024-1059046 GCACCACTGCACTCCAGTGTGGG - Intergenic
1132876634 16:2142500-2142522 GCACCACTGCACTTCAGTCTGGG + Intronic
1133300530 16:4779679-4779701 GCATCATTGAAGGTCAGTGCGGG - Exonic
1133359006 16:5158861-5158883 GCACCACTGCACTCCAGTGTGGG - Intergenic
1133792414 16:9019231-9019253 GCACCACTGCACTCCAGCGGGGG + Intergenic
1133893222 16:9901500-9901522 GCACCATTGCACTCCAGCTGGGG - Intronic
1133962813 16:10509444-10509466 GCACCATTGCACTCCAGCCGTGG + Intergenic
1134047603 16:11112620-11112642 GCACCATTGCAGTCCAGCCTGGG + Intronic
1134101914 16:11458460-11458482 GCACCATTGTACTCCAGTGTGGG + Intronic
1134263170 16:12670250-12670272 GCACCATTGCATTCCAGTTTGGG + Intronic
1134298719 16:12970551-12970573 GCACCATTGCAGTCCAGCCTGGG - Intronic
1134324283 16:13192830-13192852 GCACCATTGCACTTCAGTCTGGG + Intronic
1134448333 16:14347580-14347602 GCACCACTGCAGTCCAGTGTGGG - Intergenic
1134870605 16:17649375-17649397 GCACCATTGCACTCCAGCGTGGG - Intergenic
1135027787 16:19012085-19012107 GCACCACTGCACTTCAGTCTGGG + Intronic
1135328027 16:21539899-21539921 GCACCATTGCACTCCAGTCTGGG + Intergenic
1135382195 16:22004545-22004567 GCTCCATGGCAGGTCAGTGCAGG + Intergenic
1135561672 16:23481328-23481350 GCACCATTGCACTCCAGCCGGGG + Intronic
1135751286 16:25060335-25060357 GCACCATTGCACTTCAGCCTGGG + Intergenic
1135894775 16:26389317-26389339 GTGCCAGTGCAATTCAGTGGGGG - Intergenic
1135911473 16:26565453-26565475 GCACCATTGCATTCCAGCGTGGG + Intergenic
1135926947 16:26702970-26702992 GCACCACTGCACTTCAGCGTTGG + Intergenic
1136004567 16:27319910-27319932 GCACCATTGCACTCCAGTCTGGG - Intronic
1136077927 16:27829587-27829609 GCACCATTGCACTTCAGCCTGGG - Intronic
1136094267 16:27943615-27943637 GCACCATTCCACTTCAGTCTGGG - Intronic
1136153960 16:28370109-28370131 GCACCATTGCACTTCAGCCTGGG + Intergenic
1136209131 16:28745155-28745177 GCACCATTGCACTTCAGCCTGGG - Intergenic
1136338380 16:29625923-29625945 GCACCATTGCACTCCAGTCTGGG + Intergenic
1136446563 16:30325062-30325084 GCACCATTGCACTCCAGTCTGGG + Intergenic
1136473260 16:30495979-30496001 GCACCATTCCAATTCTGTGAGGG + Intronic
1136595259 16:31244680-31244702 GCACCATTGCACTCCAGTCTGGG - Intergenic
1136720595 16:32316799-32316821 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1136838975 16:33523081-33523103 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1136843991 16:33561253-33561275 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1137281401 16:46979866-46979888 GCGCCATTGCACTTCAGTCTGGG - Intergenic
1137418474 16:48308582-48308604 GCGCCATTGCACTCCAGTGTAGG + Intronic
1137441036 16:48498572-48498594 GCAAGACTGGAGTTCAGTGGGGG + Intergenic
1137694301 16:50450984-50451006 GCACCACTGCACTTCAGTCTGGG - Intergenic
1138002971 16:53301028-53301050 GCACCATTGCACTCCAGCGTGGG + Intronic
1138419401 16:56889517-56889539 GCACCATTGCACTCCAGCCGGGG - Intronic
1138431930 16:56974404-56974426 GCACCACTGCACTCCAGTGTGGG + Intronic
1138616311 16:58170001-58170023 GCACCATTGCACTTCAGCCTGGG + Intronic
1138700480 16:58857452-58857474 GCACCACTGCACTCCAGCGGGGG - Intergenic
1138755699 16:59481949-59481971 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1139396817 16:66646747-66646769 GCACCATTGCACTTCAGCCTGGG - Intronic
1139498339 16:67338039-67338061 GCACCATTGCAGTCCAGCCTGGG + Intronic
1139525205 16:67511477-67511499 GCACCATTGCACTCCAGTCTGGG - Intergenic
1139713451 16:68793886-68793908 GCACCATTGCACTCCAGTGTGGG + Intronic
1139713642 16:68795535-68795557 GCACCATTGCGCTCCAGTGTAGG - Intronic
1139763634 16:69208064-69208086 GCACCATTGCACTCCAGTCTGGG + Intronic
1139889346 16:70238341-70238363 GCACCATTGCACTTCAGCCTGGG + Intergenic
1140271612 16:73471449-73471471 GCACCATTGCACTTCAGCCTGGG - Intergenic
1140557303 16:75936546-75936568 GCACCATTGCACTCCAGTCTAGG + Intergenic
1141062713 16:80889281-80889303 GCACCATTGCACTCCAGTCTAGG - Intergenic
1141157031 16:81604351-81604373 GCACCATTGTACTCCAGTCGGGG + Intronic
1141978089 16:87531578-87531600 GCACCACTGCACTTCAGTCTAGG + Intergenic
1142318881 16:89367959-89367981 GCACCACTGCACTCCAGTGTGGG + Intronic
1142368681 16:89665346-89665368 GCACCATTGCAGTCCAGCCTGGG - Intronic
1142387613 16:89776208-89776230 GCACCACTGCACTCCAGTGTGGG - Intronic
1203005837 16_KI270728v1_random:200971-200993 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1203092362 16_KI270728v1_random:1224486-1224508 GCGCCACTGCACTTCAGTGTGGG + Intergenic
1203149138 16_KI270728v1_random:1823368-1823390 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1203154156 16_KI270728v1_random:1861552-1861574 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1142609164 17:1098826-1098848 GCACCATTGCACTCCAGCCGGGG - Intronic
1142647282 17:1322813-1322835 GCACCATTGCACTTCAGCCTGGG - Intergenic
1142655868 17:1393471-1393493 GCACCATTGCACTCCAGTCTGGG - Intronic
1142683557 17:1563656-1563678 GCACCATTGCACTCCAGCTGGGG + Intergenic
1142729037 17:1838558-1838580 GCACCATTGCACTTCAGCCTGGG + Intronic
1142843630 17:2654230-2654252 GCACCATTGCACTTCAGCCTAGG - Intronic
1143169136 17:4916827-4916849 GCACCACTGCAGTCCAGTCTGGG - Intergenic
1143222649 17:5275609-5275631 GCACCATTGCACTCCAGTCTGGG - Intergenic
1143241943 17:5451146-5451168 ACGCCATTGCACTTCAGTGTGGG - Intronic
1143248708 17:5506239-5506261 GCACCATTGCACTCCAGTCTGGG + Intronic
1143311964 17:5999392-5999414 GCACCATTGCACTTTAGTCTGGG + Intronic
1143316603 17:6037721-6037743 GCACCACTGGAGGTGAGTGGTGG + Intronic
1143442536 17:6986506-6986528 GCACCACTGCACTCCAGTGTGGG + Intronic
1143516556 17:7422064-7422086 GTGCCATTGCAGTCCAGTGTGGG - Intergenic
1143547622 17:7607836-7607858 GCACCATTGCACTCCAGCGTGGG - Intronic
1143553015 17:7642986-7643008 GCACCATTGCACTCCAGCGTGGG - Intergenic
1143616636 17:8055289-8055311 GCACCATTGCACTCCAGTCTGGG - Intergenic
1143653710 17:8280547-8280569 GCACCATTGCACTTCAGCCTGGG + Intergenic
1143668453 17:8379230-8379252 GCACCATTGCACTTCAGCCTAGG - Intronic
1143800316 17:9373894-9373916 GCACCATTGCATTCCAGTCAGGG + Intronic
1143915512 17:10289528-10289550 GCACCATTGCACTTCAGCCTGGG + Intergenic
1143972419 17:10805176-10805198 GCACCATTGCACTCCAGCCGGGG - Intergenic
1144298357 17:13900170-13900192 GCACCATTGCACTCCAGTCTGGG + Intergenic
1144554317 17:16268489-16268511 GCACCATTGCAGTCCAGTCTGGG - Intronic
1144637419 17:16919100-16919122 GCACCATTGCACTCCAGCGTGGG + Intergenic
1144857386 17:18277139-18277161 GCACCATTGCACTCCAGTCTGGG + Intronic
1145065481 17:19758691-19758713 GAACCACTGCACTCCAGTGGTGG + Intergenic
1145121337 17:20262965-20262987 GCACCACTGTAGTGCAGTGTGGG + Intronic
1145181894 17:20760604-20760626 GCACCACTGCACTCCAGTGTGGG - Intergenic
1145376546 17:22354504-22354526 GCACCATTGCACTTCAGCCTGGG - Intergenic
1145832073 17:27924497-27924519 GCACCATTGCAATTCAGCCTGGG + Intergenic
1146074422 17:29714907-29714929 GCACCATTGCACTTCAGCCTGGG - Intronic
1146194440 17:30799570-30799592 GCACCATTGCACTCCAGTCTGGG - Intronic
1146205892 17:30905475-30905497 GCACCATTGCACTCCAGTCTCGG + Intronic
1146292980 17:31624868-31624890 GCACCATTGCACTTCAGCCTGGG + Intergenic
1146299850 17:31679357-31679379 GTACCATTGCACTCCAGTGTGGG - Intergenic
1146327151 17:31896677-31896699 GCGCCATTGCACTTCAGTCTGGG - Intronic
1146934354 17:36802706-36802728 GCACCATTGCACTTCAGCCTGGG - Intergenic
1146967090 17:37041546-37041568 GCACCATTGCACTTCAGCCTGGG - Intronic
1147000254 17:37357448-37357470 GCACCATTGCACTCCAGTCTGGG + Intronic
1147046612 17:37757056-37757078 GCGCCATTGCACTCCAGTGAGGG - Intergenic
1147114755 17:38290687-38290709 GCACCATTGCACTCCAGTCTGGG - Intergenic
1147297353 17:39494810-39494832 GCACCACTGCAGTTCAGCCTGGG - Intronic
1147318206 17:39631024-39631046 GCACCATTGCACTCCAGTCTGGG + Intronic
1147364537 17:39951590-39951612 GCACCATTGCACTCCAGTCTGGG - Intergenic
1147532600 17:41293692-41293714 GCACCATTGCACTTCAGCCTGGG + Intergenic
1147564161 17:41526612-41526634 GCGCCATTGCACTTCAGTCTCGG - Intronic
1147675680 17:42203667-42203689 GCACCACTGCACTCCAGTGTGGG - Intronic
1147799887 17:43077371-43077393 GCACCATTGCACTTCAGCTTGGG - Intronic
1147865348 17:43548401-43548423 GCACCTTTGCACTCCAGTGTGGG - Intronic
1147867354 17:43561918-43561940 GCACCATTGCACTTCAGCCTGGG + Intronic
1148057666 17:44810814-44810836 GCACCACTGCACTCCAGTGTGGG - Intronic
1148098084 17:45068427-45068449 GCGCCATTGCACTTCAGTCTGGG + Intronic
1148230719 17:45932550-45932572 GCACCATTGCACTTCAGCCTGGG + Intronic
1148414858 17:47498517-47498539 GCACCATTGCACTCCAGTCTGGG + Intergenic
1148449032 17:47762230-47762252 GCACCATTGCACTCCAGTGTGGG + Intergenic
1148651524 17:49253526-49253548 GCACCATTGCACTCCAGCCGGGG + Intergenic
1148659830 17:49320891-49320913 GCACCACTGCACTCCAGTGTGGG - Intronic
1148689363 17:49518017-49518039 GCACCATTGCACTCCAGTCTGGG + Intergenic
1148696454 17:49562712-49562734 GCACCATTGCACTCCAGTCTGGG + Intergenic
1148920199 17:51024668-51024690 GCACCATTGCACTCCAGTCTGGG + Intronic
1149444394 17:56702577-56702599 GCACCACTGCACTCCAGTGTGGG - Intergenic
1149636868 17:58178010-58178032 GCACCATTGCACTTCAGCCTGGG + Intergenic
1149672232 17:58424741-58424763 GCACCACTGCACTCCAGTGTGGG + Intronic
1149785342 17:59429892-59429914 GCACCATTGCACTTCAGCCTGGG - Intergenic
1149833844 17:59894645-59894667 GCACCATTGCACTCCAGTCTGGG - Intronic
1149930554 17:60750122-60750144 GCACCATTGCATTCCAGTCAGGG + Intronic
1149966118 17:61165641-61165663 GCACCATTGCACTCCAGTCTGGG + Intronic
1150035263 17:61789222-61789244 GCACCATTGCACTTCATTCCGGG + Intronic
1150042586 17:61879795-61879817 GCACCACTGCAGTCCAGAGTAGG + Intronic
1150145607 17:62766455-62766477 GCACCATTGCACTCCAGTCTGGG + Intronic
1150282563 17:63937934-63937956 GCACCATTGCACTCCAGTTTGGG + Intergenic
1150429516 17:65103905-65103927 GCACCATTGCACTCCAGTCTGGG + Intergenic
1150608047 17:66710998-66711020 GCACCATTGCACTCCAGTCTGGG + Intronic
1151160033 17:72157537-72157559 GCACCATTGCACTCCAGCCGGGG + Intergenic
1151424218 17:74019739-74019761 GCACCATTGCACTCCAGTCTGGG - Intergenic
1151515804 17:74594678-74594700 ACACCATTGCACTTCAGCCGGGG + Intergenic
1151607812 17:75150894-75150916 GCACCATTGCAGTCCAGCCTGGG - Intronic
1151630435 17:75307510-75307532 GCACCATTGCACTCCAGTCTGGG - Intergenic
1151873394 17:76851585-76851607 GCACCATTGCACTTCAGCCTGGG + Intergenic
1152772276 17:82177503-82177525 GCACCATTGCACTTCAGCCTGGG + Intronic
1152970968 18:160259-160281 GCGCCATTGCACTTCAGTCTGGG + Intronic
1152979109 18:256639-256661 GCACCATTGCACTTCAGCCTGGG - Intronic
1153213804 18:2797872-2797894 GCACCATTGCACTCCAGTCCGGG + Intronic
1153233721 18:2965976-2965998 GCACCATTGCAGTCCAGCCTGGG - Intronic
1153387015 18:4510138-4510160 GCACCATTGCACTCCAGCGTGGG + Intergenic
1153421593 18:4912925-4912947 GCACCATTGCACTTCAGCCTGGG - Intergenic
1153782758 18:8508856-8508878 GCACCATTGCACTCCAGTCTGGG + Intergenic
1153870635 18:9316274-9316296 GCGCCATTGCACTTCAGTCTGGG - Intergenic
1154142971 18:11842013-11842035 GCACCATTGCACTTCAGCCTGGG - Intronic
1154155783 18:11943192-11943214 GCACCATTGCACTTCAGCATGGG + Intergenic
1154307443 18:13240970-13240992 GCACCATTGCACTCCAGCGTGGG - Intronic
1154396637 18:13996960-13996982 GCACCATTGCACTTCAGCCTGGG - Intergenic
1154421559 18:14234373-14234395 ACACCATTGCATTTCAGCCGGGG + Intergenic
1154457904 18:14546764-14546786 GCACCATTGCACTCCAGTCTGGG - Intergenic
1154472078 18:14713626-14713648 GCACCATTGCACTCCAGCCGGGG - Intergenic
1154522679 18:15246858-15246880 GCACCATTGCACTCCAGTCTGGG + Intergenic
1154967401 18:21373374-21373396 GCACCATTGCACTCCAGCGTGGG - Intronic
1155051415 18:22151121-22151143 GCACCACTGCACTCCAGTGTGGG - Intergenic
1155057402 18:22197120-22197142 GCACCATTGCACTCCAGTCTGGG - Intronic
1155221729 18:23690817-23690839 GCACCATTGCATTTCAGCCCCGG - Intronic
1155292438 18:24355456-24355478 GCACCATTGCACTCCAGCGCGGG + Intronic
1155452210 18:25975331-25975353 GCACCACTGCACTCCAGTCGGGG - Intergenic
1155470189 18:26183347-26183369 GCACCATTGCAGTCCAGCCTGGG + Intronic
1155914950 18:31547632-31547654 GCACCATTGCACTCCAGTCTGGG + Exonic
1155965249 18:32029575-32029597 GCACCACTGCACTTCAGTTTGGG + Intronic
1156043806 18:32855753-32855775 GCACCACTGCACTTCAGTCTGGG - Intergenic
1156439007 18:37165460-37165482 GCACCATTGCACTCCAGTCTGGG - Intronic
1156880533 18:42072572-42072594 GTACCACTGCACTCCAGTGGGGG - Intronic
1156984544 18:43334062-43334084 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1157340649 18:46774860-46774882 ACACCAATGCATTTCAGTAGGGG - Intergenic
1157355797 18:46932805-46932827 GCACCATTGCACTCCAGTCTGGG - Intronic
1157372125 18:47124043-47124065 GCACAATTGCAAATCAATGGGGG + Intronic
1157448365 18:47765818-47765840 GCACCATTGCACTCCAGTCTGGG - Intergenic
1157627733 18:49065403-49065425 GCACCATTGCACTTCAGCCTGGG - Intronic
1157627913 18:49067084-49067106 GCACTATGGAAGTTCAGTAGAGG + Intronic
1158058471 18:53311162-53311184 GCACCATTGCACTCCAGTCTGGG - Intronic
1158078867 18:53564926-53564948 GCACCATTGCACTCCAGTCTGGG - Intergenic
1158087271 18:53666871-53666893 GCACCAAGGCAATTCAGTGGGGG - Intergenic
1158463975 18:57672821-57672843 GCACCATTGCACTTCAGCCTGGG + Intronic
1158555691 18:58472916-58472938 TCACCCTGGCTGTTCAGTGGTGG + Intergenic
1158823427 18:61187241-61187263 GCACCATTGCACTCCAGTCTGGG + Intergenic
1158825979 18:61220084-61220106 GCACCATTGCACTCCAGTTTGGG - Intergenic
1158901572 18:61966788-61966810 GCACCACTGCACTTCAGCCGGGG - Intergenic
1159044033 18:63351824-63351846 GCACCATTGCACTTCAGCCTGGG - Intronic
1159587506 18:70294759-70294781 GGGTCATTGCAGTTCATTGGTGG + Intronic
1159596567 18:70388243-70388265 GCACCATTGCACTTCAGCCTGGG - Intergenic
1159596773 18:70389887-70389909 GCACCATTGCAGTCCAGCCTAGG - Intergenic
1159604259 18:70458426-70458448 GCACCATTGCACTCCAGTCTGGG + Intergenic
1160664926 19:321845-321867 GCGTCACTGCAGCTCAGTGGGGG + Intronic
1161004379 19:1927255-1927277 GCTCCATTGCACTCCAGTGTGGG + Intergenic
1161004387 19:1927404-1927426 GCGCCATTGCACTCCAGTGTGGG - Intergenic
1161022988 19:2020037-2020059 GCACCATTGCAGTCCAGCCCTGG - Intronic
1161033009 19:2067974-2067996 GCACCACTGCAGTTCAGCCTGGG + Intergenic
1161143349 19:2662215-2662237 GCACCATTGCACTCCAGTCTGGG + Intronic
1161206820 19:3045782-3045804 GCACCATTGCACTTCAGCCTGGG + Intronic
1161277065 19:3424417-3424439 GCACCACTGCAGTCCAGTCTGGG - Intronic
1161360187 19:3844408-3844430 GCACCACTGCACTCCAGTGTGGG - Intronic
1161480855 19:4509869-4509891 GCACCACTGCACTCCAGTGTGGG + Intronic
1161499863 19:4607929-4607951 GCGCCATTGCACTCCAGTGTGGG + Intergenic
1161533028 19:4801571-4801593 GCACCATTGCACTTCAGCCTGGG + Intergenic
1161783920 19:6311497-6311519 GCACCACTGCACTCCAGTGTGGG + Intronic
1161830710 19:6602129-6602151 GCACCATTGCAATCCAGTCTGGG + Intronic
1161883378 19:6973654-6973676 GCACCATTGCACTTCAGCCTGGG + Intergenic
1161909516 19:7182289-7182311 GCACCATTGCACTTCAGTCTGGG + Intronic
1162028433 19:7907000-7907022 GCACCATTGCACTTCAGCCTGGG + Intronic
1162149634 19:8635877-8635899 GCACCATTGCACTCCAGTTTGGG - Intergenic
1162221432 19:9179958-9179980 GCACCATTGCACTTCAGCCTGGG + Intergenic
1162304653 19:9864662-9864684 GCACCACTGCACTCCAGTGGTGG - Intronic
1162317892 19:9951924-9951946 GCACCATTGCACTTCAGCCTGGG + Intergenic
1162609878 19:11741013-11741035 GCACCATTGCACTTCAGTCTGGG - Intergenic
1162628061 19:11902022-11902044 GCACCATTGCACTTCAGCCTGGG - Intronic
1162661205 19:12170428-12170450 GCACCACTGCACTTCAGTCTGGG - Intronic
1162707279 19:12564538-12564560 GCACCATTGCACTCCAGTCTGGG - Intronic
1162854027 19:13454411-13454433 GCACCATTGCACTCCAGTCTGGG - Intronic
1162960330 19:14121971-14121993 GCACCATTGCACTTCAGCCTGGG - Intronic
1163063173 19:14774714-14774736 GCACCATTGCACTTCAGCCTGGG - Intronic
1163084390 19:14968880-14968902 GCACCATTGCACTCCAGTCTGGG - Intronic
1163206807 19:15809331-15809353 GCACCATTGCACTCCAGTCTGGG - Intergenic
1163457194 19:17414236-17414258 GCACCATTGCACTCCAGCGTGGG + Intronic
1163503329 19:17688551-17688573 GCACCATTTCAGTGCAGGTGAGG - Intergenic
1163540272 19:17904824-17904846 GCATCATTGCACTTCAGCTGGGG - Intergenic
1163706344 19:18816022-18816044 GCACCATTGCACTCCAGTCTGGG - Intergenic
1163735628 19:18978624-18978646 GCACCACTGCACTTCAGTCTGGG + Intergenic
1163881286 19:19924631-19924653 GCACCATTGCACTTCAGCCTGGG - Intronic
1163884264 19:19951886-19951908 GCACCATTGCACTCCAGTCTGGG + Intergenic
1163952445 19:20602454-20602476 GCACCACTGCACTCCAGTGTGGG - Intronic
1163971723 19:20804289-20804311 GCACCACTGCACTCCAGTTGAGG - Intronic
1164009527 19:21187693-21187715 GCACCATTGCACTCCAGTCTGGG + Exonic
1164072703 19:21783173-21783195 GCACCATTGCACTTCAGCCTGGG - Intergenic
1164076184 19:21820874-21820896 GCACCATTGCACTTCAGCCTGGG - Intronic
1164102863 19:22074392-22074414 GCACCATTGCACTTCAGTCTGGG - Intronic
1164161695 19:22629819-22629841 GCACCACTGCAGTTCAGCCTGGG + Intergenic
1164267137 19:23630041-23630063 GCACCATTGCACTCCAGCCGGGG + Intronic
1164406983 19:27958168-27958190 GCACCATTGCACTCCAGCTGTGG - Intergenic
1164470462 19:28525817-28525839 GCACCATTGCATTTCAGCCTGGG + Intergenic
1164641201 19:29827177-29827199 GCACCATGGCAGTACAGTCTGGG + Intergenic
1164681962 19:30140816-30140838 GCACCATTGCACTCCAGTCTGGG - Intergenic
1164874792 19:31676209-31676231 GCACCACTGCACTTCAGTCTGGG + Intergenic
1164972980 19:32548143-32548165 GCACCATTGCACTTCAGCCTGGG + Intergenic
1165216168 19:34274360-34274382 GCACCATTGCACTCCAGTCTGGG + Intronic
1165223391 19:34336508-34336530 ACACCATTGCACTCCAGTGTGGG - Intronic
1165532225 19:36413366-36413388 GCACCACTGCACTTCAGCGTGGG + Intronic
1165618618 19:37225136-37225158 GCACCATTGCACTTCAGCCTGGG - Intronic
1165723220 19:38094289-38094311 GCACCATTGCACTTCAGCCCAGG - Intronic
1165748582 19:38246029-38246051 GCACCATTGCATTCCAGCCGGGG + Intronic
1165949166 19:39464024-39464046 GCACCATTGCACTCCAGTCTGGG - Intronic
1166191015 19:41176688-41176710 GCACCATTGCACTTCAGCCTGGG - Intergenic
1166437808 19:42784257-42784279 GCACCATTGCACTCCAGTCTGGG + Intronic
1166456754 19:42948050-42948072 GCACCATTGCACTCCAGTCTGGG + Intronic
1166466712 19:43038919-43038941 GCACCATTGCACTCCAGTCTGGG + Intronic
1166472843 19:43095000-43095022 GCACCATTGCACTCCAGTCTGGG + Intronic
1166513599 19:43428553-43428575 GCACCATTGCACTCCAGTTTGGG + Intergenic
1166583874 19:43928136-43928158 GCACCATTGCACTCCAGTCTGGG + Intronic
1166672798 19:44721733-44721755 GCACCATTGCACTTCAGCCTGGG - Intergenic
1167171466 19:47835035-47835057 GCACCATTGCACTTCAGAGTGGG - Intronic
1167282083 19:48575518-48575540 GCACCATTGCACTCCAGTTTGGG - Intronic
1167308711 19:48723848-48723870 GCACCATTGCACTCCAGCCGGGG - Intronic
1167446439 19:49540575-49540597 GCGCCATTGCACTTCAGTCTGGG + Intronic
1167448773 19:49555299-49555321 GCACCATTGCACTTCAGCCTGGG - Intergenic
1167868885 19:52350955-52350977 GCACCATTGCACTTCAGCCTTGG + Intronic
1167885357 19:52495405-52495427 GCACCATTGTACTTCAGCGTGGG + Intronic
1167890922 19:52538583-52538605 GCACCATTGTACTTCAGCGTGGG + Intronic
1167911100 19:52702256-52702278 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1167913452 19:52721805-52721827 GCATCATTGCACTTCAGTGTGGG - Intronic
1167921082 19:52783831-52783853 GCACCATTGGACTTCAGCGTGGG - Intronic
1167927115 19:52830227-52830249 GCACCACTGCAGTCCAGCGTGGG + Intronic
1167965776 19:53145433-53145455 ACACCATTGCACTCCAGTGTAGG - Intronic
1168064461 19:53911107-53911129 GCACCATTGCACTTCAGCCTGGG - Intronic
1168077465 19:53989222-53989244 GCACCATTGCACTTCAGGCTGGG + Exonic
1168309518 19:55453295-55453317 GCAGGGTTGGAGTTCAGTGGAGG + Exonic
1168329391 19:55558113-55558135 GCACCACTGCACTTCAGTCTGGG - Intergenic
1168382079 19:55932541-55932563 GCACCATTGCACTTCAGCTTGGG - Intergenic
1168481737 19:56725738-56725760 GCACCATTGCACTTCAGCCTCGG - Intergenic
1168523306 19:57069592-57069614 GCACCACTGCAGTTCAGCCTGGG - Intergenic
1168541994 19:57220683-57220705 GCACCACTGCACTTCAGTCTGGG - Exonic
1168573511 19:57489530-57489552 GCACCATTGCAGTTTAGCCTGGG - Intronic
1168623008 19:57893875-57893897 GCACCATTGCACTCCAGCGTGGG + Intronic
1168662846 19:58181610-58181632 GCACCAATGCATTCCAGTCGGGG + Intergenic
1168685003 19:58343681-58343703 GCACCATTGCACTCCAGTCTGGG + Intergenic
1168697564 19:58413386-58413408 GCACCATTGCATTCCAGCGTGGG - Intronic
1202633484 1_KI270706v1_random:21568-21590 GCACCATTGCACTACAGTCTGGG - Intergenic
1202652393 1_KI270707v1_random:18501-18523 GCACCATTGCACTACAGTCTGGG + Intergenic
1202659741 1_KI270708v1_random:57220-57242 GCACCATTGCACTACAGTCTGGG - Intergenic
925445433 2:3923207-3923229 GCACCATTGCACTCCAGCCGGGG - Intergenic
925494449 2:4431232-4431254 GCACCATTGCACTCCAGTCTGGG - Intergenic
925680997 2:6420948-6420970 GCACCATTGCAGTCTAGTCTGGG + Intergenic
925869530 2:8256985-8257007 GCACCATTGCACTTCAGCCTGGG + Intergenic
925977740 2:9152757-9152779 GCACCATTGCACTCCAGTCTGGG + Intergenic
925983025 2:9192390-9192412 GCACCACTGCAGTTCAGCTTGGG - Intergenic
926201942 2:10807249-10807271 GCACCATTGCACTCCAGTCTGGG - Intronic
926262465 2:11278653-11278675 GCACCATTGCAGTTCAGGCTGGG - Intronic
926714106 2:15910301-15910323 GTGCCATTGCACTTCAGTGTGGG + Intergenic
926869316 2:17395073-17395095 GCAGCACTGCAAATCAGTGGGGG + Intergenic
927111078 2:19864136-19864158 GCGCCATTGCACTCCAGTGTGGG - Intergenic
927556892 2:24041294-24041316 GCACCATTGCACTTCAGCCTGGG + Intronic
927902235 2:26828813-26828835 GCACCATTGCATTCCAGTCTGGG + Intergenic
927953824 2:27193588-27193610 GCACCATTGCACTCCAGTCTGGG + Intergenic
928140139 2:28721397-28721419 GCACCATTGCACTTCAGCCTGGG + Intergenic
928225641 2:29445777-29445799 GCACCATTGCACTCCAGCGTGGG + Intronic
928242440 2:29598068-29598090 GCACCATTGCACTCCAGTCTGGG - Intronic
928315501 2:30241500-30241522 GCACCATTGCACTTCAGCCTGGG - Intronic
928397534 2:30954401-30954423 GCACCATTGCACTCCAGCTGAGG - Intronic
928583940 2:32738570-32738592 CCACCATTTCAGTTGAGTTGTGG + Intronic
928804692 2:35136630-35136652 GCACCATTGCACTTCAGCCTGGG - Intergenic
929002204 2:37358392-37358414 GCACCATTGCACTTCAGCCTGGG + Intronic
929100110 2:38303246-38303268 GCACCATTGCACTCCAGTCTGGG - Intronic
929140150 2:38660078-38660100 GCACCATTGCACTCCAGTCTGGG - Intergenic
929186979 2:39105855-39105877 GCACCATTGCACTTCAGCCTGGG + Intronic
929216183 2:39415908-39415930 GCACCATTGCACTCCAGTCTGGG + Intronic
929364595 2:41138059-41138081 GCACCATTGCACTACAGTCTGGG + Intergenic
929499664 2:42479601-42479623 GCACCACTGCACTTCAGTCTGGG + Intronic
929540788 2:42818972-42818994 GCACCACTGCACTCCAGTGTGGG + Intergenic
930172655 2:48267271-48267293 GCAACACTGCTGTTAAGTGGAGG - Intergenic
930265590 2:49195555-49195577 GCACCATTGCATTTCAGCCTAGG - Intergenic
931308202 2:61053182-61053204 GCACCACTGCACTCCAGTGTGGG + Intergenic
931311495 2:61085400-61085422 GTACTAGTGCAATTCAGTGGGGG - Intronic
931361056 2:61578260-61578282 GCACCATTGCACTTCAGCCTGGG + Intergenic
931585065 2:63817150-63817172 GCACCATTGCACTTCAGCCTGGG - Intronic
931758094 2:65392220-65392242 GCACCACTGCACTCCAGTGTAGG - Intronic
931784884 2:65609796-65609818 GCACCATTGCACTTCAGCCTGGG - Intergenic
931823208 2:65973069-65973091 GCACCATTGCACTTCAGCCTGGG + Intergenic
932125106 2:69138039-69138061 GCACCATTGCACTCCAGCCGAGG + Intronic
932183009 2:69666159-69666181 ACACCATTGCACTCCAGTGTGGG + Intronic
932691119 2:73914514-73914536 GCACCACTGCACTTCAGTCTGGG + Intronic
933005031 2:76981535-76981557 GCACCACTGCACTTCAGTCTAGG - Intronic
933495353 2:83043689-83043711 GCACCACTGCACTTCAGTCTGGG - Intergenic
933518153 2:83332129-83332151 GCACCATTTCTGTTGAGTTGGGG - Intergenic
933658526 2:84907819-84907841 GCACCATTGCAGTCCAGTCTGGG - Intergenic
933684142 2:85129843-85129865 GCACCATTGCACTCCAGTCTGGG + Intergenic
933833662 2:86229650-86229672 GCACCATTGCACTCCAGTCTGGG - Intronic
933867067 2:86530035-86530057 GCACCATTGCACTCCAGCGTGGG - Intronic
933882505 2:86684551-86684573 GCACCATTGCACTACAGTCTGGG - Intronic
934086164 2:88511712-88511734 GCACCATTGCACTTCAGCTTGGG - Intergenic
934098891 2:88632951-88632973 GCACCATTGCACTCCAGCCGGGG - Intergenic
934534374 2:95121073-95121095 GCACCATTGCACTCCAGCCGGGG + Intronic
934957868 2:98639241-98639263 GCACCATTGCACTCCAGTCTGGG + Intronic
934971292 2:98766536-98766558 GCACCATTGCACTTCAGCCTGGG - Intergenic
935263393 2:101374332-101374354 GCACCATTGCACTCCAGTGTGGG + Intronic
935308646 2:101760958-101760980 GCGCCATTGCACTCCAGTGTGGG + Intronic
935485210 2:103644906-103644928 GCACCATTGCATTTTAGTCCGGG + Intergenic
935672495 2:105567678-105567700 GCACCATTGCACTTCAGCCTGGG + Intergenic
935987318 2:108687737-108687759 GCACCATTGCACTCCAGCTGAGG - Intergenic
936391260 2:112076207-112076229 GCACCATTGCACTTCAGCCTGGG + Intronic
936488922 2:112953388-112953410 GCACCATTGCACTTCAGCCTGGG - Intergenic
936777350 2:115989887-115989909 GCACCATTGCACTTCAGACTAGG - Intergenic
937196929 2:120165923-120165945 GCACCATTGCACTCCAGTCTGGG + Intronic
937255041 2:120549317-120549339 GCACCATTGCACTCCAGTCTGGG - Intergenic
937407862 2:121647323-121647345 GCACCATTGCACTTCAGCCTGGG + Intronic
937511914 2:122605469-122605491 GCACCACTGCACTCCAGTGTGGG - Intergenic
937600136 2:123721727-123721749 GCACCATTGCAGTCCAGCCTGGG - Intergenic
937640467 2:124205459-124205481 GCACCATTGCAGTCCAGCCTGGG - Intronic
937837769 2:126490317-126490339 GCACCACTGCACTTCAGTCTGGG + Intergenic
938164137 2:129011364-129011386 GCACCATTGCACTCCAGTCTGGG + Intergenic
938521966 2:132079711-132079733 GCACCATTGCACTCCAGTCTGGG + Intergenic
938530158 2:132176746-132176768 GCACCACTGCATTTCAGTCTGGG + Intronic
938743586 2:134255831-134255853 GCAACAGTTCAGTTCAGTGCAGG + Intronic
938822386 2:134972499-134972521 GCACCATTGCATTCCAGATGGGG - Intronic
938961461 2:136345255-136345277 GCACCATTGCATTCCAGTCTGGG + Intergenic
939154917 2:138513505-138513527 GCACCACTGCACTCCAGTGTAGG + Intronic
939250683 2:139678338-139678360 GCACCATTGCACTTCAGCCTGGG - Intergenic
939940682 2:148347330-148347352 GCACCATTGCACTCCAGTCTGGG + Intronic
940010680 2:149051706-149051728 GCACCACTGCACTTCAGTCTCGG - Intronic
940086293 2:149862600-149862622 GCACCATTGCACTCCAGTTTGGG + Intergenic
940199411 2:151133346-151133368 GCACCATTGCACTCCAGCCGGGG + Intergenic
940212287 2:151267540-151267562 GCACCACTGCACTCCAGTGTGGG + Intergenic
940452314 2:153854536-153854558 GCACCATTGCAGTCCAGCTTGGG + Intergenic
940710332 2:157155127-157155149 GCACCATTGCACTCCAGTCTGGG + Intergenic
940783736 2:157960170-157960192 GCACCATTGCACTCCAGTCTGGG - Intronic
940931824 2:159441690-159441712 GCACCATTGCACTCCAGCGTAGG - Intronic
941392803 2:164935638-164935660 GCACCATTGCACTCCAGTCTGGG + Intronic
941569198 2:167148337-167148359 GCACCATTGCACTCCAGTGTGGG + Intronic
941794978 2:169588914-169588936 GCACCATTGCACTTCAGCCTGGG + Intronic
941903831 2:170702385-170702407 GCACCATTGCACTTCAGCCTGGG + Intergenic
942295642 2:174514629-174514651 GCACCATTGCAGTCCAGCCTGGG + Intergenic
942632307 2:177963917-177963939 TCACGATGACAGTTCAGTGGAGG - Intronic
942660827 2:178263433-178263455 GCACCATTGCACTTCAGCCTGGG + Intronic
942721307 2:178956337-178956359 GCACCATTGCATTTCAGTCTGGG - Intronic
942760835 2:179395255-179395277 GCACCATTGCACTTCAGCCTGGG + Intergenic
943463999 2:188205820-188205842 GCACCATTGCACTCCAGTCTGGG + Intergenic
943468572 2:188262921-188262943 GCACCATTGCACTTCAGCCTGGG - Intergenic
943754738 2:191546102-191546124 GCACCACTGCACTTCAGTCTGGG - Intergenic
943814292 2:192231952-192231974 GCACAATTCCAGTTCAGAGAAGG - Intergenic
944152463 2:196574385-196574407 GCACCACTGCACTCCAGTGTGGG + Intronic
944569794 2:201032697-201032719 GCACCACTGCAGTCCAGCTGAGG - Intronic
944594113 2:201245908-201245930 GCACCATTGCACTCCAGTCTGGG - Intronic
944633701 2:201654017-201654039 GCACCATTGCACTCCAGTCTGGG - Intronic
944724609 2:202457770-202457792 ACACCATTGCACTCCAGTGTGGG - Intronic
944753006 2:202730625-202730647 GCACCACTGCACTCCAGTTGGGG + Intronic
944798891 2:203215966-203215988 GCACCACTGCACTACAGTGTGGG + Intronic
944808268 2:203303650-203303672 GCGCCATTGCACTCCAGTGTGGG + Intronic
945146623 2:206744880-206744902 GCACCACTGCACTTCAGTCTGGG + Intronic
945188124 2:207160324-207160346 GCACCATTCAAGTTAAGTTGGGG + Intronic
945432041 2:209776002-209776024 GCAGGGTTGCAGTGCAGTGGAGG - Exonic
945489474 2:210438175-210438197 GCACCATTGCACTTCAGCCTGGG - Intronic
946100810 2:217319746-217319768 GCACCACTGCACTTCAGTCTGGG + Intronic
946216825 2:218190488-218190510 GCACCACTGCACTCCAGTGTGGG + Intergenic
946282384 2:218675565-218675587 GCACCATTGCACTTCAGCCTGGG - Intronic
946345938 2:219110478-219110500 GCACCATTGCACTCCAGTCTGGG + Intronic
946694778 2:222343947-222343969 GCACCATTGCACTCCAGTCTGGG + Intergenic
946759057 2:222975104-222975126 GCACCATTGCATTCCAGTCTTGG - Intergenic
946982435 2:225232006-225232028 GCACCACTGCAGTCCAGTGTGGG + Intergenic
947231757 2:227894371-227894393 GCACCATTGCACTCCAGTCTGGG + Intronic
947410483 2:229833327-229833349 GCACCATTGCACTTCAGCTTGGG - Intronic
947423020 2:229957532-229957554 GCACCATTGCACTTCAGCCTGGG + Intronic
947483451 2:230524311-230524333 GCACCATTGCACTTCAGCCTGGG + Intronic
947498374 2:230655342-230655364 GCACCATTGCACTCCAGTTTGGG - Intergenic
947666316 2:231908087-231908109 GCACCACTGCAGTCCAGTCTAGG - Intergenic
947786666 2:232828493-232828515 ACACCATTGCACTTCACTGTGGG - Intronic
948452450 2:238084546-238084568 GCACCACTGCACTTCAGTCTGGG + Intronic
948471727 2:238185759-238185781 GCACCACTGCACTTCAGCCGGGG + Intronic
948517472 2:238512874-238512896 GCACCATTGCACTTCAGCCTGGG - Intergenic
948571172 2:238918119-238918141 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1168867451 20:1100125-1100147 GCACCATTGCACTCCAGTCTGGG - Intergenic
1168869618 20:1117378-1117400 GCACCATTGCACTTCAGCCTGGG - Intronic
1169184378 20:3601819-3601841 GCACCATTGTACTCCAGTGTGGG + Intronic
1169326874 20:4683769-4683791 GCACCATTGCACTTCAGCCTGGG - Intergenic
1169374137 20:5052833-5052855 GCACCACTGCATTTCAGTCTGGG - Intergenic
1169453096 20:5728968-5728990 GCACCATTGAACTTCAGTCTGGG - Intergenic
1169610422 20:7373738-7373760 GCACCATTGCACTCCAGTCTGGG - Intergenic
1170023686 20:11865105-11865127 GCACCATTGCACTTCAGCCTGGG + Intergenic
1170521434 20:17189807-17189829 GCACCATTGCACTCCAGTCTGGG + Intergenic
1170562156 20:17567816-17567838 GCACCATTGCACTACAGTCTGGG + Intronic
1170653075 20:18260576-18260598 GTACCATTGAAGGTCCGTGGTGG - Intergenic
1170844304 20:19949237-19949259 GCACCATTGCACTTCAGCCTGGG + Intronic
1170844494 20:19950930-19950952 GCACCACTGCACTTCAGCGGGGG - Intronic
1171019022 20:21568299-21568321 CCTCCATTTCATTTCAGTGGGGG - Intergenic
1171029164 20:21661705-21661727 GCACATTTGCACTTCAGAGGTGG - Intergenic
1171529402 20:25842697-25842719 GCACCACTGCAGTTCAGCCTAGG + Intronic
1171547424 20:26013183-26013205 GCACCACTGCAGTTCAGCCTAGG - Intergenic
1171906999 20:30907492-30907514 GCACCATTGCACTCCAGTCTGGG - Intergenic
1171970949 20:31564799-31564821 GCACCATTGCACTCCAGTCTGGG + Intronic
1172018613 20:31896570-31896592 GCACCACTGCACTCCAGTGTGGG - Intronic
1172039375 20:32032986-32033008 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1172082595 20:32354042-32354064 GCACCATTGCACTCCAGTGTAGG + Intergenic
1172461662 20:35123547-35123569 ACACCATTGCACTTCAGTCTGGG + Intronic
1172503748 20:35445619-35445641 GCACCATTGCACTCCAGTCTGGG + Intronic
1172558903 20:35868248-35868270 GCACCATTGCAGTCCAGCCTGGG + Intronic
1172713514 20:36945859-36945881 GCACCATTGCACTCCAGTCTGGG + Intronic
1172728366 20:37064972-37064994 GCACCACTGCACTTCAGTCTAGG - Intronic
1172754477 20:37273579-37273601 GCACCATTGCACTTCAGCCTGGG - Intergenic
1172815058 20:37679755-37679777 GCACCATTGCACTCCAGCGTGGG - Intergenic
1172971607 20:38877350-38877372 GCACCATTGCACTCCAGCGTGGG - Intronic
1173152155 20:40576727-40576749 GCACCATTGCACTCCAGCCGGGG + Intergenic
1173245314 20:41333534-41333556 GCACCACTGCAGTCCAGTCTGGG + Intergenic
1173346153 20:42202010-42202032 GCACCACTGCACTCCAGTGTAGG - Intronic
1173423234 20:42921540-42921562 GCACCACTGCACTTCAGTCTGGG + Intronic
1173661671 20:44738502-44738524 GCACCATTGCACTCCAGCGTAGG + Intergenic
1173722069 20:45268205-45268227 GCACCATTGCACTTCAGCATGGG + Intergenic
1173805667 20:45923630-45923652 GCACCATTGCACTTCAGCCTGGG - Intergenic
1174096767 20:48096023-48096045 GCACCATTGCACTCCAGTCTGGG + Intergenic
1174341586 20:49900504-49900526 GCACCAGTGCAGTCCAGCGTGGG - Intergenic
1174347329 20:49940009-49940031 GCACCATTGCACTTCAGCCTGGG + Intronic
1174472840 20:50773337-50773359 GCGCCATTGCACTCCAGTGGGGG - Intergenic
1174557336 20:51405248-51405270 GCATCATTGAAGTCTAGTGGTGG - Intronic
1174595874 20:51683047-51683069 GCACCATTGCACTCCAGCGTGGG + Intronic
1174824506 20:53757157-53757179 GCACCATTGCACTCCAGCGTGGG + Intergenic
1174835068 20:53849330-53849352 GCACCATTGCACTTGAGTCTGGG + Intergenic
1174898245 20:54473258-54473280 GCACCATTGCACTTCAGCCTGGG - Intergenic
1174911963 20:54617371-54617393 GCACCACTGCAGTTCAGCCTGGG - Intronic
1174967506 20:55234566-55234588 GCACCACTGCACTCCAGTGTGGG - Intergenic
1175079653 20:56408474-56408496 GCACCATTGCACTTCAGCCTGGG + Intergenic
1175087759 20:56474436-56474458 GCACCATTGCACTCCAGCCGGGG + Intronic
1175099035 20:56565061-56565083 GCACCAGTGCAGTCCAGCGTGGG + Intergenic
1175128341 20:56769253-56769275 GCACCATTGCACTTCAGCCTGGG + Intergenic
1175433358 20:58923621-58923643 GCACCATTGCACTCCAGTCTGGG + Intergenic
1176176204 20:63726563-63726585 GCACCATTGCACTTCAGCCTGGG - Intronic
1176301198 21:5099880-5099902 GCACCATTGCACTCCAGTCTGGG + Intergenic
1176599754 21:8781152-8781174 GCACCATTGCACTACAGTCTGGG - Intergenic
1176628293 21:9113854-9113876 GCACCATTGCACTACAGTCTGGG + Intergenic
1176766342 21:13022998-13023020 GCACCACTGCACTTCAGTCTGGG - Intergenic
1176774717 21:13121356-13121378 GCACCATTGCACTCCAGTCTGGG - Intergenic
1176816249 21:13606532-13606554 GCACCATTGCACTCCAGTCTGGG + Intergenic
1177882357 21:26709382-26709404 GCACCAGTGCACTTCAGTCTGGG - Intergenic
1178005345 21:28212895-28212917 GCACCATTGCACTCCAGTCTAGG + Intergenic
1178336014 21:31744283-31744305 GTTCCAATGCAGTTCAATGGAGG - Intergenic
1178536428 21:33413873-33413895 GCACCATTGCACTCCAGTCTGGG - Intronic
1178848079 21:36190280-36190302 GCACCACTGCACTCCAGTGTTGG + Intronic
1178970862 21:37175552-37175574 GCACCATTGCACTCCAGTCTGGG + Intronic
1179055749 21:37932176-37932198 GCACCACTGCACTTCAGTCTGGG - Intergenic
1179662340 21:42884817-42884839 GCACCATTGCACTTCAGACTGGG - Intronic
1179855831 21:44162018-44162040 GCACCATTGCACTCCAGTCTGGG - Intergenic
1180327214 22:11440782-11440804 GCACCATTGCACTACAGTCTGGG - Intergenic
1180367229 22:11951722-11951744 GCACCATTGCACTACAGTCTGGG + Intergenic
1180430914 22:15249535-15249557 GCACCACTGCATTTCAGTCTGGG - Intergenic
1180626601 22:17197993-17198015 GCACCATTGCACTCCAGTCTGGG + Intronic
1180662507 22:17480995-17481017 GCACCATTGCACTCCAGCGTGGG + Intronic
1180923933 22:19539421-19539443 GCACCATTGCACTCCAGTCTGGG + Intergenic
1181036646 22:20172886-20172908 GCACCATCACAGTTCACTGCAGG + Intergenic
1181156845 22:20927798-20927820 GCACCATTGCACTCCAGTCTGGG + Intronic
1181285681 22:21750681-21750703 GCACCATTGCACTCCAGTCTAGG - Intergenic
1181299750 22:21871137-21871159 GCACCATTGCACTCCAGTCTGGG + Intergenic
1181542765 22:23582606-23582628 GCACCATTGCACTTCAGCCTGGG - Intergenic
1181564815 22:23729311-23729333 GCACCATTGCACTTCAGCCTTGG - Intergenic
1181691919 22:24567701-24567723 GCACCATTGCACTTCAGCCTGGG + Intronic
1181723683 22:24795956-24795978 GCACCATTGCACTCCAGTCTGGG + Intergenic
1182206507 22:28633235-28633257 GCACCATTGCACTCCAGTCTGGG + Intronic
1182222055 22:28766472-28766494 GCACCACTGCAGTCCAGCGTGGG + Intergenic
1182274989 22:29182475-29182497 GCACCATTGCACTTCAGCCTGGG + Intergenic
1182448101 22:30401554-30401576 GCACCATTGCAGTCCAGCCTGGG - Intronic
1182506291 22:30785522-30785544 GCGCCATTGCACTCCAGTGTGGG + Intronic
1182567166 22:31208778-31208800 GCACCAGTGCACTCCAGTCGGGG + Intergenic
1182667955 22:31972831-31972853 GCACCACTGGAGTGCAGTCGAGG - Intergenic
1182850993 22:33474204-33474226 GCACCATTGCACTTCAGCCTAGG - Intronic
1182890081 22:33810764-33810786 GCACCATTGCAGTCCAGCCTGGG - Intronic
1183139926 22:35927559-35927581 GCACCATTGCACTCCAGCCGGGG + Intronic
1183160070 22:36107324-36107346 GCACCATTGCACTTCAGCCTGGG - Intergenic
1183195123 22:36348464-36348486 ACACCATTGCACTCCAGCGGGGG + Intronic
1183521729 22:38299564-38299586 GCACCATTGCACTCCAGTCTGGG - Intronic
1183637675 22:39074604-39074626 GCACCATTGCAGTCCAGTCCGGG + Intronic
1183660399 22:39216662-39216684 GCACCATTGCACTCCAGTCTGGG + Intergenic
1183671500 22:39275536-39275558 GCACCATTGCACTCCAGTCTGGG + Intergenic
1183779757 22:39991623-39991645 GCACCATTGCACTCCAGTCTGGG - Intergenic
1183819433 22:40333292-40333314 GCACCACTGCACTCCAGTGTGGG + Exonic
1183819859 22:40337388-40337410 GCACCATTGCACTTCAGCCTGGG + Intergenic
1183961900 22:41416268-41416290 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1183992426 22:41606729-41606751 GCACCACTGCACTTCAGTCTGGG + Intronic
1184062493 22:42092130-42092152 GCACCATTGCAGTCCAGCCTAGG - Intergenic
1184119205 22:42439542-42439564 GCACCATTGCACTCCAGTCTGGG - Intergenic
1184182752 22:42842045-42842067 GCACCATTGCACTCCAGCCGGGG - Intronic
1184329089 22:43814677-43814699 GCACCATTGCACTCCAGTCTAGG - Intergenic
1184456429 22:44612858-44612880 GCACCACTGCACTCCAGTGCAGG - Intergenic
1184492460 22:44817762-44817784 GCACCATTGCACTCCAGTCTGGG + Intronic
1184562474 22:45271196-45271218 GCACCACTGCAGTCCAGTCTGGG - Intergenic
1185033503 22:48458453-48458475 GCACCATTGCACTTCAGTCTGGG + Intergenic
1185145439 22:49132799-49132821 GCACCATTGCACTTCAGCCTGGG - Intergenic
1185287154 22:50006910-50006932 GCACCACTGCACTTCAGCGTGGG + Intronic
949272433 3:2234333-2234355 GCACCATTGCACTCCAGCCGGGG + Intronic
949360463 3:3227128-3227150 ACACCATTGCACTCCAGTGTGGG - Intergenic
949382397 3:3460731-3460753 GCACCACTGCACTCCAGTGTGGG + Intergenic
949428796 3:3950058-3950080 GCACCACTGCACTCCAGTGTGGG - Intronic
949664970 3:6327899-6327921 GCGCCATTGCACTCCAGTGTGGG - Intergenic
949992158 3:9588453-9588475 GCACCATTGCAGTCCAGCCTGGG + Intergenic
950010039 3:9716511-9716533 GCACCATTGCACTTCAGCCTGGG - Intronic
950026576 3:9824451-9824473 GCGCCATTGCACTCCAGTGTGGG - Intronic
950049895 3:9980054-9980076 GCGCCATTGCAGTTCAGCCTGGG - Intronic
950293220 3:11804905-11804927 GCACCACTGCACTTCAGTCTGGG - Intronic
950774254 3:15336089-15336111 GCACCATTGCACTCCAGCGTGGG + Intronic
951318337 3:21214395-21214417 GCACCATTGCACTCCAGTCTGGG - Intergenic
951427226 3:22562098-22562120 GCACCATTGCACTCCAGTCTGGG - Intergenic
951482571 3:23177309-23177331 GCACCATTGCACTCCAGCGTGGG + Intergenic
951981184 3:28568673-28568695 GCGCCATTGCACTCCAGTGTGGG + Intergenic
952083758 3:29793186-29793208 GCACCACTGCACTTCAGTCTGGG + Intronic
952107962 3:30091310-30091332 GCACCACTGCACTCCAGCGGGGG - Intergenic
952328499 3:32342203-32342225 GCACCACTGCAGTCCAGCGTAGG + Intronic
952439555 3:33312097-33312119 GCACCATTGCACTCCAGTCTGGG - Intronic
952972440 3:38660437-38660459 GCACCATTGCACTCCAGCCGGGG - Intergenic
953419510 3:42743458-42743480 GCACCACTGCACTCCAGTCGGGG - Intronic
953653601 3:44828992-44829014 ACACCATTGCACTCCAGTGTGGG + Intronic
953983274 3:47423434-47423456 ACACCACTGCACTTCAGTGTGGG - Intronic
953984699 3:47432718-47432740 ACACCATTGCAGTCCAGCTGGGG - Intronic
953993992 3:47505612-47505634 GCACCATTGCACTCCAGTCTGGG - Intronic
954001299 3:47559428-47559450 GCACCACTGCACTTCAGTCTGGG - Intergenic
954022987 3:47758972-47758994 GCACCATTGCACTCCAGCCGGGG + Intronic
954027503 3:47794832-47794854 GCACCATTGCACTGCAGTCTGGG - Intergenic
954093602 3:48304413-48304435 GCACCATTGCACTCCAGTGTGGG - Intergenic
954095327 3:48321769-48321791 GCACCATTACACTTCAGCGTGGG + Intronic
954319966 3:49825608-49825630 ACACCACTGCAGTTCAGCCGGGG - Intergenic
954323408 3:49847337-49847359 GCACCACTGCACTCCAGTGTGGG + Intronic
954338266 3:49933306-49933328 GCACCATTGCACTTCAGCCTGGG - Intergenic
954562068 3:51565516-51565538 GCACCACTGCACTCCAGTGTGGG - Intronic
954768614 3:52944858-52944880 GCACCACTGCACTTTAGTGTGGG - Intronic
954827443 3:53386629-53386651 GCACCATTGCACTCCAGTCTGGG - Intergenic
954908444 3:54083113-54083135 GCACCATTGCACTTCAGTCTGGG + Intergenic
955216906 3:56991674-56991696 GCACGATCGCAGTTCACTGAAGG + Intronic
955280022 3:57585703-57585725 GCACCATTGCACTTCAGCCTGGG - Intronic
955400291 3:58586653-58586675 GCACCACTGCACTCCAGTCGGGG + Intronic
955604645 3:60688472-60688494 GCACCATTGCATTCCAGCTGGGG - Intronic
955717913 3:61850203-61850225 GCACCATTGCACTCCAGCAGGGG - Intronic
955892683 3:63666561-63666583 GCACCATTGCACTCCAGCCGGGG + Intronic
956134398 3:66084610-66084632 GCACCATTGCACTCCAGTCTGGG + Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956437082 3:69244588-69244610 GCACCATTGCACTTCAGCCTGGG + Intronic
956551825 3:70469533-70469555 GCACCACTGCACTCCAGTGTGGG + Intergenic
956792376 3:72690192-72690214 GCACCATTGCACTCCAGTCTGGG - Intergenic
956819098 3:72936595-72936617 GCACCATTGCACTCCAGTCTGGG + Intronic
956968440 3:74491455-74491477 GCACCACTGCACTCCAGTGTTGG + Intronic
957094509 3:75766062-75766084 GCACCATTGCACTACAGTCTGGG + Intronic
957296752 3:78342499-78342521 CCACCATTGTGGCTCAGTGGTGG - Intergenic
957763854 3:84594984-84595006 GCACCACTGCACTTCAGTCTGGG + Intergenic
957840244 3:85659007-85659029 GCACCATTGCACTTCAGCCTGGG + Intronic
957891911 3:86370526-86370548 GCACCATTGCACTTCAGCCTGGG - Intergenic
958197448 3:90259332-90259354 ACACCATTGCACTCCAGTGTAGG + Intergenic
958693763 3:97502209-97502231 GCACCATTGCACTCCAGCGTGGG - Intronic
958966963 3:100569872-100569894 GCACTCTTGGAGTTCAGGGGAGG + Intronic
959662580 3:108885977-108885999 GCGCCATTGCAGTCCAGTGTAGG - Intergenic
959700050 3:109290178-109290200 GTACCATTGCACTCCAGCGGGGG + Intergenic
959923989 3:111901315-111901337 GCACCATTGCACTCCAGTCTGGG + Intronic
960364995 3:116760598-116760620 GCACCATTGCACTTCAGCCTGGG - Intronic
960374162 3:116878054-116878076 GCACCATTGCACTTCAGCCTGGG + Intronic
960397049 3:117150783-117150805 GCACCATTGCATTCCAGCCGGGG - Intergenic
961239590 3:125398917-125398939 GCACCACTGCACTCCAGTGTGGG + Intergenic
961247775 3:125471299-125471321 GCGCCATTGCACTCCAGTGTGGG + Intronic
961261128 3:125602667-125602689 GCACCATTGCATTTCAGCCTGGG + Intergenic
961285148 3:125796069-125796091 GCACCATTGCACTCCAGTCTGGG + Intergenic
961338402 3:126199878-126199900 GCACCATTGCACTCCAGTCTGGG + Intergenic
961484144 3:127205763-127205785 GCACCATTGCACTTCAGCCTGGG - Intergenic
961631678 3:128304744-128304766 GCACCATTGCATTCCAGTCTGGG - Intronic
961696025 3:128705344-128705366 GCACAATTGCGGTTCACTGCAGG - Intergenic
961696393 3:128708332-128708354 GCACCACTGCACTTCAGTCTGGG - Intergenic
961743991 3:129051855-129051877 GCACCACTGCACTCCAGTGTGGG + Intergenic
961842545 3:129728326-129728348 GCACCATTGCACTCCAGTCTAGG - Intronic
962038682 3:131682558-131682580 GACCCAGTGCAGTCCAGTGGTGG - Intronic
962533567 3:136305704-136305726 GCACCATTGCATTTCAGCCTGGG + Intronic
963255002 3:143136205-143136227 GCTTCATTGCAGTTCAGCGTGGG - Intergenic
963533575 3:146500380-146500402 GCGCCATTGCACTTCAGTCTGGG + Intergenic
963858740 3:150284562-150284584 GCACCATTGCACTCCAGTCTGGG - Intergenic
964347675 3:155770709-155770731 GCACCATTGCACTTCAGCCTGGG - Intronic
964355763 3:155850657-155850679 GCACCATTGCATTCCAGTCTAGG - Intronic
964357954 3:155867707-155867729 GCACCATTGCACTTCAGCCTAGG + Intergenic
964408932 3:156378573-156378595 ACACCACTGGAGTTCAGAGGAGG - Intronic
964496198 3:157292938-157292960 GCACCATTGCACTCCAGTCTGGG + Intronic
964609076 3:158591200-158591222 GCACCATTGCACTCCAGACGGGG - Intronic
965107583 3:164377124-164377146 GCACCATTGCACTCCAGCGTGGG - Intergenic
965109073 3:164398811-164398833 GCACCATTGCACTCCAGTCTGGG + Intergenic
965560058 3:170052975-170052997 GTACCAATGCAATTCAATGGAGG - Intronic
965795754 3:172436971-172436993 GCACCATTGCACTTCAGCCCTGG + Intergenic
965826203 3:172733312-172733334 GCACCAAAGCAATCCAGTGGGGG - Intergenic
965984130 3:174731188-174731210 GCAGCATTGCAGCTCAGTATGGG - Intronic
966087918 3:176092823-176092845 GCACCATTGCACTCCAGTCTGGG - Intergenic
966608678 3:181846991-181847013 GCACCATTGCACTTCAGCCTGGG - Intergenic
966893368 3:184424475-184424497 GCACCATTGCACTCCAGTCTGGG - Intronic
966908667 3:184545488-184545510 GCACCATTGCACTTCAGCCTGGG - Intronic
967074784 3:185992320-185992342 GCACCATTGCACTCCAGTCTGGG - Intergenic
967603223 3:191414009-191414031 GCACCATTGCACTCCAGCCGGGG + Intergenic
968183309 3:196613229-196613251 ACACCATTGCACTCCAGTGTGGG + Intergenic
968261665 3:197330280-197330302 GCACCATTGCACTTCAGCCTGGG - Intergenic
1202741188 3_GL000221v1_random:57635-57657 GCACCATTGCACTACAGTCTGGG + Intergenic
968387692 4:157153-157175 GCACCATTGCACTCCAGCGTGGG - Intronic
968710626 4:2113940-2113962 GCACCATTGCACTTCAGACTGGG - Intronic
969174895 4:5391006-5391028 GCACCATTGCACTCCAGCGTGGG - Intronic
969248135 4:5948916-5948938 GCACCATTGCACTTCAGCCTGGG + Intronic
969408476 4:7011597-7011619 GCACCATTGCACTCCAGTCTGGG - Intronic
969504101 4:7573558-7573580 GCACCATTGCACTTCAGCCTGGG - Intronic
969532503 4:7737562-7737584 TCACCACTGCAGTGAAGTGGAGG - Intronic
970586926 4:17523255-17523277 GCACCACTGCACTTCAGTCTGGG - Intronic
970630755 4:17941414-17941436 GCACCATTGCATTTCAGTCTGGG + Intronic
970639617 4:18049847-18049869 GCAACACTGCACTTCAGTGTGGG - Intergenic
970661524 4:18290836-18290858 GCACCATTGCACTCCAGTCTGGG + Intergenic
970851753 4:20612198-20612220 GCACCATTGCAGTACAGCCTGGG + Intronic
970874346 4:20851970-20851992 GCACCACTGCAGTCCAGTTTGGG + Intronic
971295176 4:25381902-25381924 GCACCACTGCACTCCAGTGTGGG + Intronic
971321098 4:25606681-25606703 GCACCATTGCACTCCAGTCTAGG + Intergenic
971619025 4:28829961-28829983 TCACCATTGCACTCCAGTGTGGG + Intergenic
972508316 4:39742696-39742718 GCACCATTGCACTCCAGTCTGGG + Intronic
972512701 4:39784617-39784639 GCACCATTGCATTTCAGCCTGGG + Intergenic
972545101 4:40072766-40072788 GCACCATTGCAGTCCAGCGTGGG - Intronic
972576120 4:40353446-40353468 GCACCACTGCACTCCAGTGTGGG + Intronic
972599698 4:40561272-40561294 GCACCATTGCACTCCAGTCTGGG - Intronic
972611325 4:40658090-40658112 GCACCATTGCACTCCAGCGTGGG + Intergenic
972644832 4:40957624-40957646 GCACCATTGCACTCCAGCCGGGG - Intronic
972820292 4:42694189-42694211 GCACCATTGCAGTCCAGCCTAGG - Intergenic
972836777 4:42880546-42880568 GCACCACTGCACTCCAGCGGGGG - Intergenic
973210419 4:47609280-47609302 GCGCCATTGCACTTCAGCCGGGG - Intronic
973291134 4:48471761-48471783 GCACCATTGCACTTCAGCTGGGG + Intergenic
973315317 4:48753894-48753916 GCACCAAGACAATTCAGTGGGGG - Intronic
973363111 4:49183574-49183596 GCACCATTGCACTACAGTCTGGG - Intergenic
973397982 4:49613286-49613308 GCACCATTGCACTACAGTCTGGG + Intergenic
973777473 4:54256585-54256607 GCACCATTGCACTCCAGTGTGGG - Intronic
973919257 4:55668295-55668317 GCACCATTGCACTCCAGTCTGGG - Intergenic
973933333 4:55816424-55816446 GCACCACTGCACTCCAGTGTGGG - Intergenic
974043845 4:56880892-56880914 GCACCATTGCAGTCCAGTCTGGG - Intergenic
974330396 4:60470076-60470098 GCACCATTACAGTCCAGTCTGGG + Intergenic
974376735 4:61087869-61087891 GCACCATTGCACTCCAGTTCGGG - Intergenic
974699295 4:65418924-65418946 GCACCATTGCACTCCAGTCTGGG - Intronic
975113517 4:70652758-70652780 GCACCATTGCACTTCAGCCTGGG + Intronic
975342200 4:73255764-73255786 GCACCATTGCAGTCCAGCCTGGG - Intronic
975844922 4:78515023-78515045 GCACCATTGCACTCCAGTCTGGG + Intronic
975895514 4:79085475-79085497 GCACCATTGCACTCCAGTCTGGG - Intergenic
976173056 4:82324681-82324703 GCACCATTGCACTCCAGTCTAGG - Intergenic
976193374 4:82510234-82510256 GCACCACTGCACTTCAGTCTAGG + Intronic
976244429 4:82993257-82993279 GCACCATTGCACTTCAGCCTGGG - Intronic
976253649 4:83078538-83078560 GCACCATTGCACTCCAGTCTGGG + Intergenic
976868503 4:89761459-89761481 TAACAATTGCAATTCAGTGGTGG - Intronic
977101134 4:92816270-92816292 GCACCATTGCACTCCAGTCTGGG + Intronic
977126201 4:93171634-93171656 CAACCATTCCTGTTCAGTGGAGG + Intronic
977205534 4:94161240-94161262 GCACCATTGCAGTCCAGCCTGGG + Intergenic
977255042 4:94731427-94731449 GCACCATTGCACTTCAGCCTGGG - Intergenic
977278976 4:95015427-95015449 GCACCACTGCAGTCCAGACGGGG - Intronic
978509693 4:109503100-109503122 GCACCACTGCAGTTCAGCCTGGG - Intronic
978658137 4:111091078-111091100 GCACCATTGCACTTCAGTCTGGG + Intergenic
979200751 4:117975169-117975191 GCACCATTGCAATTCAGCCTGGG - Intergenic
979249606 4:118551903-118551925 GCACCATTGCACTCCAGTCTGGG + Intergenic
979282431 4:118882810-118882832 GCACCATTGCACTTCAGCCTGGG - Intronic
979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG + Intronic
979758167 4:124367575-124367597 GCACCATTGCACTTCAGCCTGGG - Intergenic
980092732 4:128459283-128459305 TCCCCATTGCAGTGCAGTTGGGG + Intergenic
980119434 4:128712606-128712628 GCACCATTGCACTCCAGCGTGGG - Intergenic
980142840 4:128941908-128941930 GCACCATTGCAGTTCAGTGGGGG - Intronic
980153245 4:129074742-129074764 GCACCATTGCACTCCAGTTTGGG - Intronic
980229732 4:130033914-130033936 GCACCATTGCACTCCAGTCTGGG - Intergenic
980598863 4:134992662-134992684 GCACCATTGCACTCCAGTCTGGG + Intergenic
980742218 4:136966506-136966528 GCATCATTGTAGTCCAGTGTGGG + Intergenic
980889254 4:138796647-138796669 GCACCATTGCACTCCAGCTGGGG - Intergenic
980953872 4:139408638-139408660 GCACCATTGCACTTCAGCCTGGG + Intronic
980985298 4:139689320-139689342 GCACCACTGAAGGGCAGTGGTGG + Intronic
981025719 4:140075577-140075599 GCACCATTGCACTCCAGTCTGGG - Intronic
981298476 4:143159910-143159932 GCACCACTGCACTCCAGTGTGGG + Intergenic
981826878 4:148953238-148953260 GCACCATTGCACTTCAGCCTGGG - Intergenic
982036246 4:151348861-151348883 GCACCATTGCACTCCAGTGTGGG + Intergenic
982041791 4:151404925-151404947 GCACCATTGCACTTCAGCCTAGG - Intergenic
982105178 4:152005508-152005530 GCACCATTGCACTCCAGTCTGGG - Intergenic
982567669 4:157007055-157007077 GCACCATTGCACTCCAGTCTGGG - Intergenic
982599923 4:157435889-157435911 GCACCATTGCACTTCAGCCTGGG - Intergenic
982686406 4:158495005-158495027 GCACCATTGCACTTCAGCTTGGG + Intronic
982860307 4:160440603-160440625 GCACCACTGCACTTCAGTCTGGG - Intergenic
983830054 4:172315304-172315326 GCACCATTGCATTCCAGCGTGGG - Intronic
983942905 4:173554656-173554678 GCACCATTGCACTGCAGTCTGGG + Intergenic
984042583 4:174754010-174754032 GCACATTTCCAGTTCTGTGGAGG - Intronic
984262528 4:177458950-177458972 GCACCATTGCACTCCAGTCTGGG + Intergenic
984981065 4:185281971-185281993 GCACCATTGCACTCCAGTCTGGG + Intronic
984982401 4:185295490-185295512 GCACCACTGCACTTCAGCGTGGG - Intronic
985141992 4:186849759-186849781 GCACCATTGCACTTCAGCCTGGG + Intergenic
985146300 4:186897660-186897682 GCACCATTACATTCCAGTGTGGG - Intergenic
985241052 4:187931172-187931194 GCACCATTGCACTCCAGCTGGGG - Intergenic
985316129 4:188660346-188660368 GCACCATTGCACTCCAGGGTGGG + Intergenic
985937060 5:3105706-3105728 GCACCACTGCCGTACAGAGGAGG + Intergenic
986016089 5:3758290-3758312 GCACCATTGCACTCCAGCGCAGG + Intergenic
986621999 5:9685906-9685928 GCACCATTGCACTTCAGCTTGGG - Intronic
986817324 5:11427318-11427340 GCACCACTGCACTTCAGCGTGGG - Intronic
987238023 5:15963126-15963148 GCACCATTGCACTCCAGTCTAGG - Intergenic
987343134 5:16956012-16956034 GCACCATTGCACTCCAGTCTGGG + Intergenic
987382429 5:17298071-17298093 GCACCATTGCACTTCAGCCTGGG - Intergenic
987636438 5:20547516-20547538 GCACCATTGCACTCCAGTCTGGG + Intronic
987766653 5:22240574-22240596 GCACCATTGCAGTCCAGCCTAGG - Intronic
988358900 5:30210714-30210736 GCACCACTGCACTTCAGTCTGGG - Intergenic
988410364 5:30878240-30878262 GCACCATTGCAGTCCAGCCTGGG - Intergenic
988501802 5:31789873-31789895 GCACCACTGCATTCCAGTGTGGG + Intronic
988514636 5:31893935-31893957 GCACCATTGCACTTCAGCCTGGG - Intronic
989184698 5:38612136-38612158 GTACCATTGCACTCCAGTGTGGG + Intergenic
989384298 5:40838996-40839018 GCACCATTGCACTCCAGTCAGGG + Intergenic
989399862 5:40997275-40997297 GCACCATTGCATTCCAGTCTGGG + Intergenic
989582484 5:43045767-43045789 GCATCACTGCAGTTCAGTCTGGG + Intergenic
990220752 5:53585697-53585719 GCGCCATTGCACTCCAGTGTGGG + Intronic
990331361 5:54729520-54729542 TCACCATTGCACTTCAGTCTGGG - Intergenic
990549072 5:56854387-56854409 GCACCATTGCACTCCAGTCTGGG + Intronic
990576274 5:57126437-57126459 GCACCATTGCACTCCAGCGTGGG - Intergenic
990644264 5:57826236-57826258 ACACCATTGCACTTCAGTCTGGG - Intergenic
991142534 5:63261457-63261479 GCACCATTGCACTTCAGCTTGGG - Intergenic
991188497 5:63839481-63839503 GCACCATTGCAGTCCAATCTGGG + Intergenic
991328144 5:65461200-65461222 GCTCTATTGGAGCTCAGTGGAGG - Intronic
991385556 5:66085006-66085028 GCACCATTGCACTCCAGTCTGGG - Intergenic
991471846 5:66977141-66977163 GCACCATTGCACTCCAGTCTGGG - Intronic
991689429 5:69212304-69212326 GCACCATTGCACTTCAGCCTGGG - Intergenic
991702716 5:69331273-69331295 GCACCATTGCACTCCAGCGTGGG - Intronic
991704273 5:69343506-69343528 GCACCACTGCACTCCAGTGTAGG - Intergenic
991914492 5:71592336-71592358 GCACCATTGCACTCCAGCCGGGG + Intronic
992627025 5:78645623-78645645 GCACCATTGCACTCCAGTCTGGG - Intronic
992684433 5:79185751-79185773 GCACCATTGCACTCCAGTCCGGG + Intronic
992695880 5:79286598-79286620 GCACCACTGCACTCCAGTGTGGG + Intronic
992803849 5:80317604-80317626 GCACCACTGCACTCCAGTGTGGG - Intergenic
993071885 5:83175649-83175671 ACACCACTGCACTTCAGTGTGGG - Intronic
993091705 5:83434458-83434480 GCACCATTGCACTTCAGCCTGGG - Intergenic
993340824 5:86723402-86723424 GCACCATTGCACTCCAGTCTGGG - Intergenic
993646263 5:90467087-90467109 GCACCATTGCACTTCAGCCTGGG + Intronic
993757603 5:91750947-91750969 GCAGCTTTGCAGTGCTGTGGTGG + Intergenic
994071224 5:95605164-95605186 GCACCATTGCACTCCAGTCTGGG - Intergenic
994422156 5:99535145-99535167 GCACCACTGCACTCCAGTGTGGG - Intergenic
994460685 5:100065435-100065457 GCACCACTGCACTCCAGTGTGGG + Intergenic
994647242 5:102485206-102485228 GCACCATTGCATTCCAGTCTGGG + Intronic
995078191 5:108012969-108012991 GCACCATTGCATTCCAGTCTGGG + Intronic
995230413 5:109754956-109754978 GCACCATTGCACTTCAGCCTGGG + Intronic
995349190 5:111155659-111155681 GCACCAGTGCACTCCAGTGTGGG + Intergenic
995373781 5:111450743-111450765 GCACCATTGCACTCCAGTCTGGG + Intronic
995437296 5:112151448-112151470 GCACCACTGCACTCCAGTCGGGG - Intronic
995480045 5:112584353-112584375 GCACCATGGCAGTTCCATTGTGG - Intergenic
996331676 5:122336641-122336663 GCACCATTGCACTCCAGTCTGGG - Intronic
996537466 5:124593476-124593498 GCACCATTGCACTTCAGCCTGGG - Intergenic
996584650 5:125071965-125071987 GCACCATTGCACTCCAGTCTGGG - Intergenic
996710894 5:126542620-126542642 GCACCACTGCACTCCAGTGTGGG + Exonic
996866567 5:128130637-128130659 GCACCACTGCACTTCAGCGTGGG + Intronic
997118260 5:131148834-131148856 GCACCATTGCACTCCAGTGTGGG + Intergenic
997146740 5:131442828-131442850 GCACCATTGCACTTCAGCCCGGG - Intronic
997165427 5:131656027-131656049 GCACCATTGCACTCCAGTCTGGG + Intronic
997183726 5:131860486-131860508 ACACCACTGCAGTCCAGTGTGGG - Intronic
997272611 5:132554322-132554344 GCACCATTGCACTCCAGTCTGGG + Intronic
997322689 5:132991744-132991766 GCACCATTGCACTCCAGTGTGGG - Intergenic
997323630 5:133001346-133001368 GCACCATTGCACTCCAGTTTGGG + Intronic
997323952 5:133004215-133004237 GCACCATTGCACTTCAGCCTAGG - Intronic
997460032 5:134045716-134045738 GCACCATTGCACTTCAGCCTGGG - Intergenic
997537824 5:134636214-134636236 GCACCATTGCACTCCAGTCAGGG + Intronic
997550252 5:134746093-134746115 GCACCATTGCACTTCAGCCTGGG + Intronic
997993261 5:138564144-138564166 GCACCACTGCAGTCCAGTCTGGG - Intronic
998841518 5:146259459-146259481 GCACCATTGCACTCCAGTCTGGG + Intronic
998869137 5:146535166-146535188 GCACCATTGCACTCCAGCCGGGG + Intergenic
998937676 5:147248076-147248098 GCACCATTGCACTCCAGCCGGGG + Intronic
998990363 5:147808595-147808617 GCACCATTGCACTCCAGTCTGGG + Intergenic
999193818 5:149768484-149768506 GCACCACTGCACTCCAGTGTGGG - Intronic
999334763 5:150706014-150706036 GCACTATTGCACTCCAGTGTAGG - Intergenic
999648077 5:153738763-153738785 GCACCATTGCATTTCAGCCTGGG - Intronic
999681038 5:154060407-154060429 GCACCATTGCACTCCAGTCTGGG - Intronic
999859365 5:155628862-155628884 GCACCATTGCACTCCAGTCTGGG + Intergenic
1000054324 5:157591348-157591370 GCACCATTGCACTTCAGCCTGGG - Intergenic
1000120982 5:158197688-158197710 GGACTATTGCGGTTCAGGGGAGG - Intergenic
1000253404 5:159516151-159516173 GCACCATTGCACTTCAGCCTGGG - Intergenic
1000288492 5:159847838-159847860 GAACCATTGAGGTTCTGTGGGGG + Intergenic
1000306585 5:160000437-160000459 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1000320513 5:160130764-160130786 GCACCATTGCACTTCAGCCTGGG + Intergenic
1000419391 5:161021077-161021099 GCACCATTGCATTCCAGTCTGGG + Intergenic
1000705210 5:164502485-164502507 GCACCATTGCATTTCAGCCTGGG + Intergenic
1000783182 5:165510392-165510414 GCACCATTGCACTCCAGCTGAGG + Intergenic
1001389542 5:171367760-171367782 GCACCATTGCACTTCAGTGTGGG - Intergenic
1001739579 5:174040948-174040970 GTGCCATTGCACTCCAGTGGGGG + Intergenic
1002142824 5:177154736-177154758 GCACCATTGCATTCCAGCTGGGG - Intronic
1002178014 5:177413319-177413341 GCACCATGGCAGTCCAGTTTGGG - Intronic
1002451987 5:179324431-179324453 GCACCACTGCACTCCAGTTGGGG - Intronic
1003303077 6:4902361-4902383 GCACCATTGCACTCCAGTCTGGG + Intronic
1003481322 6:6536395-6536417 GCACCATTGCACTCCAGTTTAGG - Intergenic
1003821710 6:9905508-9905530 GCACCATTGCACTTCAGCCTGGG - Intronic
1003822322 6:9912641-9912663 GCACCCATGCAGTTCCTTGGGGG + Intronic
1003861613 6:10327162-10327184 GCACCATTGCACTTCAGCCTGGG + Intergenic
1003864026 6:10347435-10347457 GCACCATTGCACTTCAGCCTGGG + Intergenic
1003895604 6:10604814-10604836 GCACCACTGCAGTTCAGCCTGGG + Intronic
1003943341 6:11050169-11050191 GCACCATTGCACTTCAGCCTGGG + Intergenic
1003943625 6:11052721-11052743 GCACCATTGCACTCCAGTCTGGG + Intergenic
1004019628 6:11765368-11765390 GCACCATTGCACTTCAGCCTGGG - Intronic
1004079517 6:12377919-12377941 GCACCATTGCACTCCAGTCTGGG - Intergenic
1004371961 6:15060428-15060450 GCACCATTGCACTTCAGCCTGGG + Intergenic
1004443321 6:15674372-15674394 GCACCATTGCATTCCAGTCTGGG + Intergenic
1004512414 6:16293753-16293775 GCACCATTGCACTCCAGTCTGGG + Intronic
1004659720 6:17699438-17699460 GCACCATTGCACTTCAGCCTGGG + Intronic
1004772226 6:18796638-18796660 GAACCATTGCACTCCAGTTGTGG - Intergenic
1004807297 6:19217657-19217679 GCACCACTGCAGTTTTGGGGAGG - Intergenic
1004925312 6:20410659-20410681 GCACCATTGCATTTCAGCCTGGG - Intronic
1004942997 6:20580830-20580852 GCACCATTGCACTTCAGCCTGGG - Intronic
1005327238 6:24714656-24714678 GCACCATTGCACTCCAGTGTGGG - Intronic
1005490394 6:26342476-26342498 GCACCATTGCACTTCAGCCTGGG - Intergenic
1005722911 6:28620250-28620272 GCACCATTGCATTTCAGCCTGGG + Intergenic
1005850879 6:29819969-29819991 GCACCACTGCAGTTCAGCCTGGG + Intergenic
1005853057 6:29836983-29837005 GCACCATTGCACTCCAGCTGGGG + Intergenic
1005918627 6:30377968-30377990 GCACCATTGCACTCCAGTCTGGG + Intergenic
1005946232 6:30598053-30598075 GCACCATTGCACTCCAGTCTGGG - Intergenic
1005971552 6:30765829-30765851 GCACCATTGCACTCCAGTCTGGG - Intergenic
1006093761 6:31643375-31643397 GCACCATTGCACTCCAGTCTGGG + Intronic
1006546337 6:34784987-34785009 GCACCACTGCACTTCAGTCTGGG + Intergenic
1006547149 6:34789788-34789810 GCACCATTGCACTCCAGCGTGGG - Intergenic
1006605911 6:35257999-35258021 GCACCATTGCAGTCCAGCGCGGG - Intergenic
1006614235 6:35314362-35314384 GCACCATTGCACTTCAGCCTGGG + Intronic
1006754253 6:36400925-36400947 GCACCATTGCACTCCAGTCTGGG + Intronic
1006772620 6:36566369-36566391 GCACCATTGCACTCCAGTCTGGG - Intergenic
1006964638 6:37970083-37970105 GCACCATTGCACTCCAGTTTGGG + Intronic
1007127090 6:39434526-39434548 GCACCATTGCACTTCAGCCTGGG + Intronic
1007531450 6:42546592-42546614 GCACCATTGCACTTCAGCATGGG + Intergenic
1007606570 6:43122097-43122119 GCATCACTGCACTTCAGTGTGGG + Intronic
1007832648 6:44650535-44650557 GCACCATTGCACTCCAGTCTAGG + Intergenic
1008005370 6:46404177-46404199 GCACCATTGCACTCCAGGGTGGG + Intronic
1008216195 6:48792829-48792851 GCACCATTGCAATTCAGTCTGGG - Intergenic
1008588986 6:52974735-52974757 GCACCATTGCACTCCAGTTTGGG + Intergenic
1008862912 6:56172341-56172363 GCACCATTGCAGGCCAGGAGTGG + Intronic
1009322027 6:62303449-62303471 GCACCATTGCACTTCAGCCTAGG - Intergenic
1009354057 6:62718146-62718168 GCACCATTGCACTCCAGTCTCGG + Intergenic
1009416357 6:63420158-63420180 GCACCACTGCACTCCAGCGGAGG + Intergenic
1009817260 6:68752317-68752339 GCACCATTGCACTCCAATGTGGG - Intronic
1010080569 6:71856443-71856465 GCACCATTGCACTTCAGCTTGGG + Intergenic
1010233188 6:73553562-73553584 GCACCATTGCACTCCAGCGTGGG - Intergenic
1010233459 6:73555446-73555468 GCACCATTGCACTTCAGCCTGGG + Intergenic
1010748838 6:79595245-79595267 GCGCCATTGCACTCCAGTGTGGG + Intergenic
1011020952 6:82811801-82811823 GCACCACTGCACTTCAGTCTGGG - Intergenic
1011038226 6:83000885-83000907 GCCCCATTGCACTTCAGTCTGGG - Intronic
1011109405 6:83820525-83820547 GCACCACTGCACTTCAGTTTAGG + Intergenic
1011222858 6:85075094-85075116 GCAGCACTGCAGATCATTGGGGG + Intergenic
1011273122 6:85600135-85600157 GCACCATTGCACTCCAGTCTGGG + Intronic
1011479919 6:87783809-87783831 GCACCATTGCACTCCAGTCTGGG - Intergenic
1011495254 6:87931156-87931178 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1011660619 6:89591144-89591166 GCACCATTGCACTTCAGTCTGGG - Intronic
1011706874 6:90009704-90009726 GCACCATTGCACTTCAGCCTGGG - Intronic
1012005620 6:93709346-93709368 GTACCATTGCAGTCCAGTCTGGG + Intergenic
1012390993 6:98739999-98740021 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1012668487 6:102010424-102010446 GCACCATTGCACTTCAGCCTGGG - Intronic
1013062155 6:106645463-106645485 GCACCATTGCACTCCAGTCTGGG - Intronic
1013082792 6:106827097-106827119 GCACCACTGCACTCCAGTGTAGG + Intergenic
1013230107 6:108154797-108154819 GCACCATTGCATTTCAGCCTGGG + Intronic
1013358571 6:109371291-109371313 GCACCATTGCACTCCAGTCTGGG - Intronic
1013784961 6:113769061-113769083 GCACCATTGCTGTCCAGTCTGGG - Intergenic
1013822116 6:114167026-114167048 GCACCACTGCACTTCAGTGTGGG - Intronic
1014285598 6:119494048-119494070 GTACCACAGCAGTTCAGAGGAGG + Intergenic
1014436250 6:121424037-121424059 GCACCATTGCACTCCAGCGCAGG + Intergenic
1014608773 6:123514310-123514332 GCACCACTGCACTTCAGTCTGGG + Intronic
1014665780 6:124235639-124235661 GCACCATTGCACTCCAGTCTGGG - Intronic
1014740165 6:125140238-125140260 GCACCATTGCACTCCAGTTTGGG - Intronic
1015108381 6:129564381-129564403 GCACCATTGCACTCCAGTCTGGG - Intergenic
1015111166 6:129593416-129593438 GCACCATTGCACTTCAGCCTGGG + Intronic
1015177965 6:130331674-130331696 GCACCATTGCACTCCAGTCTGGG + Intronic
1015393236 6:132707181-132707203 GCACCATTGCACTTCAGCCTGGG + Intronic
1015467436 6:133562738-133562760 GCACCATTGCACTCCAGTCTGGG - Intergenic
1015596897 6:134874768-134874790 GCACCATTGCACTTCAGCCTGGG - Intergenic
1015637129 6:135288050-135288072 GCACCATTGCAGTCCAGCCTGGG + Intronic
1016047308 6:139493903-139493925 GCACCACTGCACTTCAGTCTGGG + Intergenic
1016208131 6:141495621-141495643 GCACCATTGCACTTCAGCCTGGG - Intergenic
1016328915 6:142935506-142935528 GCACCACTGCACTCCAGTGGGGG + Intronic
1016391225 6:143578160-143578182 GAACCATTGCAGTCAAGTGCAGG + Intronic
1016961032 6:149672899-149672921 GCACCATTGCACTCCAGTCTGGG + Intronic
1017078129 6:150638659-150638681 TAACAATTGCTGTTCAGTGGTGG + Intronic
1017115368 6:150971237-150971259 GCACCACTGCACTCCAGTGTGGG - Intronic
1017162227 6:151376058-151376080 GCACAAAAGCAATTCAGTGGAGG + Intronic
1017177102 6:151515323-151515345 ACACCATTGCACTTCAGTCTGGG - Intronic
1017345578 6:153376679-153376701 GCACCATTGCACTCCAGTCTGGG - Intergenic
1017352017 6:153453885-153453907 GCACCATTGCACTTCAGCCTGGG - Intergenic
1017425967 6:154321735-154321757 GCACCATTGCATTTCAGCCTGGG + Intronic
1017766960 6:157614811-157614833 GCACCATTGCACTCCAGCGTGGG - Intronic
1017910553 6:158788602-158788624 GCACCATTGCACTCCAGCCGGGG + Intronic
1018012931 6:159688191-159688213 CCACCATTGAACTTCAGTGCAGG + Exonic
1018213956 6:161508885-161508907 GCACCATTGCACTCCAGTCTCGG - Intronic
1018668245 6:166159127-166159149 GCACCATTGCACTCCAGTCTGGG + Intronic
1018699439 6:166415020-166415042 GCACCATTGCACTCCAGAGTGGG + Intronic
1018734106 6:166674709-166674731 GCACCATTGCACTCCATTGTGGG - Intronic
1019412603 7:912889-912911 GCACCACTGCACTCCAGTGTGGG - Intronic
1019667776 7:2260663-2260685 TCACCCTTGCTGTTCAGTCGGGG - Intronic
1019778711 7:2927411-2927433 GCACCATTGCACTTCAGCCTGGG - Intronic
1019907610 7:4076511-4076533 GCACCATTGCACTTCAGCCTGGG + Intronic
1020054074 7:5104895-5104917 ACACCATTGCACTCCAGTGTGGG - Intergenic
1020074943 7:5251707-5251729 GCACCATTGCATTCCAGCGTGGG - Intergenic
1020171774 7:5850687-5850709 GCACCACTGCACTCCAGTTGGGG - Intergenic
1020205565 7:6112405-6112427 GCACCATTGCATTTCAGCCTGGG + Intronic
1021499317 7:21312159-21312181 GCACCACTGCACTTCAGTCTGGG + Intergenic
1021851402 7:24812262-24812284 GCACCACTGCACTTCAGAGTGGG + Intronic
1021956066 7:25825736-25825758 GCACCATTGCACTGCAGTGTGGG - Intergenic
1022001563 7:26230886-26230908 GCACCATTGCACTCCAGTCTGGG + Intergenic
1022147680 7:27562532-27562554 GCACCACTGCACATCAGTGTGGG - Intronic
1022272302 7:28820645-28820667 GCACCACTGCACTTCAGTCTGGG - Exonic
1022688647 7:32622712-32622734 GCGCCATTGCACTCCAGTGTAGG + Intergenic
1022899631 7:34792839-34792861 GCACCATTGCACTTCAGCCTGGG + Intronic
1023020183 7:36004844-36004866 ACACCATTGCACTTCAGTCCGGG + Intergenic
1023397838 7:39767871-39767893 GCACCACTGCAGTCCAGTCTGGG - Intergenic
1023624271 7:42100697-42100719 GCACCACTGCACTCCAGTGTGGG + Intronic
1023725019 7:43134349-43134371 GCACCATTGCACTCCAGTGTGGG + Intronic
1023746127 7:43323989-43324011 GCACCATTGCACTCCAGTTTGGG + Intronic
1023791006 7:43753760-43753782 GCACCATTGCACTCCAGTCTGGG - Intergenic
1023801901 7:43842396-43842418 ACACCATTGCACTTCAGTCTGGG - Intergenic
1023802814 7:43849642-43849664 GCACCATTGCACTCCAGTCTGGG + Intergenic
1023803345 7:43853780-43853802 GCACCATTGCACTTCAGCCTGGG - Intergenic
1023948023 7:44819050-44819072 GCACCATTGCAATCCAGTCTGGG + Intronic
1025134829 7:56402621-56402643 GCACCACTGCAGTCCAGTCTGGG + Intergenic
1025140198 7:56456568-56456590 GCACCATTGCACTTCAACGTGGG + Intergenic
1025168488 7:56734871-56734893 GCACCATTGCACTTCAGCCTGGG + Intergenic
1025188168 7:56877032-56877054 GCACTATTGCACTCCAGTGTGGG - Intergenic
1025192614 7:56907557-56907579 GCACCATTGGACTCCAGTGTGGG - Intergenic
1025250042 7:57345713-57345735 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1025651561 7:63474106-63474128 GCACCATTGCACTCCAGTCTGGG + Intergenic
1025679331 7:63669363-63669385 GCACCATTGGACTCCAGTGTGGG + Intergenic
1025683755 7:63699888-63699910 GCACTATTGCACTCCAGTGTGGG + Intergenic
1025804269 7:64814718-64814740 GCACCATTGCACTCCAGCGTGGG + Intronic
1025827522 7:65022726-65022748 GCACCATTGCACTCCAGCTGGGG - Intergenic
1025862257 7:65341950-65341972 GCACCATTGCACTTCAGCCTGGG - Intergenic
1025929925 7:65985395-65985417 GCACCATTGCACTCCAGTTGGGG - Intergenic
1025942677 7:66085648-66085670 GCACCATTGCACTTCAGCCTGGG - Intronic
1025978761 7:66390763-66390785 GCACCACTGCATTCCAGTGTAGG - Intronic
1025984871 7:66441062-66441084 GCGCCATTGCACTCCAGTGTAGG - Intergenic
1026058890 7:67008703-67008725 GCACCATTGCACTCCAGTCTGGG - Intronic
1026259434 7:68741452-68741474 GCACCATTGCACTCCAGTCTGGG + Intergenic
1026265976 7:68796452-68796474 GCACCATTGCACTTCAGACTGGG - Intergenic
1026533014 7:71216172-71216194 GCACCATTGCACTTCAGCATGGG + Intronic
1026804080 7:73418662-73418684 GCACCATTGCACTTCAGCCTGGG - Intergenic
1026921568 7:74159423-74159445 GCACCACTGCACTCCAGTTGGGG + Intergenic
1026931815 7:74227082-74227104 GCACCATTGCACTTCAGCCTGGG - Intronic
1026983980 7:74543257-74543279 GCACCATTGCACTTCAGCCTGGG + Intronic
1027114100 7:75464811-75464833 GCACCATTGCACTCCAGTCTGGG + Intronic
1027387664 7:77674592-77674614 GCACCATTGCACTTCAGTCTGGG + Intergenic
1027401746 7:77816115-77816137 GCACCATTGCATTTCAGCCTGGG - Intronic
1027591567 7:80125646-80125668 GCACCATTGCACTCCAGTCTGGG - Intergenic
1027854863 7:83498518-83498540 GCACCACTGCACTCCAGCGGGGG - Intronic
1027862282 7:83600360-83600382 GCACCATTGCACTCCAGTCTGGG - Intronic
1027898357 7:84075499-84075521 GCACCATTGCACTCCAGTCTTGG - Intronic
1028111338 7:86946427-86946449 GCACCATTGCACTCCAGTCTGGG - Intronic
1028178964 7:87693982-87694004 GCTCCCGTGCAGCTCAGTGGCGG - Intronic
1028399069 7:90405103-90405125 GCACCACTGCACTCCAGTGTTGG - Intronic
1028607881 7:92674872-92674894 GCACCATTGCATTCCAGTCTGGG - Intronic
1028827837 7:95294309-95294331 GCACCACTGCAGTCCAGTCTGGG - Intronic
1029291949 7:99508854-99508876 GCACCATTGCACTACAGTCTGGG - Intronic
1029471380 7:100756809-100756831 GCACCATTGCACTCCAGCGTGGG - Intronic
1029986755 7:104929662-104929684 GCACCATTGCACTTCAGCCTGGG + Intergenic
1030017958 7:105243586-105243608 GCACCATTGCACTCCAGTCTGGG + Intronic
1030529944 7:110699723-110699745 GCACCACTGCACTTCAGTCTGGG + Intronic
1031013333 7:116546652-116546674 GCACCATTGCACTTCAGACTGGG + Intronic
1031801857 7:126256876-126256898 GCACCATTGCACTACAGTATGGG + Intergenic
1032164559 7:129535062-129535084 GCACCATTGCACTCCAGTCTGGG + Intergenic
1032386839 7:131531013-131531035 GCACCATTGCACTCCAGTCTGGG + Intronic
1032594052 7:133221575-133221597 GCACCATTGCACTTCAGCCTGGG + Intergenic
1032608878 7:133389528-133389550 GCACCATTGCACTCCAGTCTGGG + Intronic
1032788029 7:135216892-135216914 GCACCATTGCACTTCAGTCTGGG - Intergenic
1032870377 7:135978325-135978347 CCACCATTGCCGTACAGTGTAGG + Intergenic
1032939448 7:136771958-136771980 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1033043075 7:137936375-137936397 CCAGCCTTGCACTTCAGTGGTGG + Intronic
1033101796 7:138479860-138479882 GCACCATTGCACTCCAGTCTGGG - Intronic
1033117699 7:138640272-138640294 GCACCATTGCACTCCAGTTGGGG - Intronic
1033329359 7:140405261-140405283 GCACCATTGCAGTCCAGCCTGGG - Intronic
1033408107 7:141090226-141090248 GCACCATTGCACTCCAGCCGGGG - Intronic
1033801188 7:144904377-144904399 ACAACAATTCAGTTCAGTGGAGG - Intergenic
1033809665 7:144996933-144996955 GCACCATTGCACTCCAGTCTGGG + Intergenic
1034073385 7:148209166-148209188 GCACCATTGCACTCCAGCTGGGG - Intronic
1034325710 7:150230180-150230202 GCACCATTGCACTCCAGTCTGGG + Intergenic
1034510866 7:151533622-151533644 GCACCATTGCACTCCAGTCTGGG - Intergenic
1034643381 7:152623198-152623220 GCACCATTGCACTCCAGTCTGGG - Intergenic
1034645331 7:152641260-152641282 GCACCATTGCACTTCAGCCTGGG + Intergenic
1034693978 7:153037888-153037910 ACACCACTGCAGTTGAGTGAGGG - Intergenic
1036088900 8:5643339-5643361 GCACCATTGCACTCCAGCCGGGG + Intergenic
1036140923 8:6207324-6207346 GCACCATTGCACTCCAGTCTGGG + Intergenic
1036170243 8:6476384-6476406 GCACCATTGCACTCCAGTCTGGG + Intronic
1036194977 8:6706494-6706516 GCACCATTCCAGTAAAGGGGAGG + Intergenic
1036251313 8:7165335-7165357 GCACCATTGCACTCCAGTCTGGG - Intergenic
1036366176 8:8122125-8122147 GCACCATTGCACTCCAGTCTGGG + Intergenic
1036588746 8:10148602-10148624 GCACCATTGCACTTCAGCCTGGG + Intronic
1036959261 8:13225953-13225975 GCACCACTGCAGTCCAGTTTGGG - Intronic
1037039248 8:14210503-14210525 GCACCATTGCACTCCAGTCTGGG - Intronic
1037109190 8:15145507-15145529 GCACCACTGCACTTCAGCGTAGG - Intronic
1037646111 8:20794164-20794186 GCACCATTGCACTCCAGTCTGGG + Intergenic
1037750284 8:21677412-21677434 GCACCATTGCACTCCAGTCTGGG - Intergenic
1037852119 8:22340093-22340115 GCACCATTGCACTTCAGCCTGGG - Intronic
1038292698 8:26264180-26264202 GCACCATTGCAGTCCAGCCTGGG - Intergenic
1038417762 8:27409762-27409784 GCACCATTGCACTTCAGCCTGGG - Intronic
1038553480 8:28489655-28489677 GCACCACTGCAGTTCAGCCTGGG + Intronic
1038739393 8:30203514-30203536 GCACCATTGCACTCCAGTCTGGG + Intergenic
1038742616 8:30228797-30228819 GCACCACTGCACTCCAGTGTGGG - Intergenic
1039012380 8:33108800-33108822 GCACCATTGCACTTCAGCTTGGG + Intergenic
1039064141 8:33594764-33594786 GCACCATTGCACTTCAGCCTGGG - Intronic
1039237057 8:35513269-35513291 GCACCATTGCACTTCAGCCTCGG - Intronic
1039283577 8:36013075-36013097 GCACCATTGCACTCCAGCGTGGG + Intergenic
1039615467 8:38951747-38951769 GCACCACTGCACTTCAGTCTGGG - Intronic
1039656937 8:39420358-39420380 GCACCATTGCACTTCAGCCTGGG + Intergenic
1039867696 8:41519982-41520004 GCACCATTGCACTCCAGTATGGG - Intergenic
1039982942 8:42424356-42424378 GCACCATTGCACTTCAGCCTGGG - Intronic
1040002897 8:42594392-42594414 GCACCATTGCACTTTAGTCTGGG - Intergenic
1040035819 8:42868807-42868829 GCACCATTGCACTCCAGTCTGGG + Intronic
1040642668 8:49357740-49357762 GCGCCATTGCAGTCCAGTCTGGG - Intergenic
1040758609 8:50810349-50810371 GCACCATTGCACTCCAGCGTGGG - Intergenic
1040777594 8:51065014-51065036 GCACCATTGCATTCCAGTCTGGG + Intergenic
1041051884 8:53942228-53942250 GCACCATTGCACTTCAGCCTGGG + Intronic
1041134390 8:54740991-54741013 GCACCATTGCACTCCAGTCTGGG + Intergenic
1041242966 8:55863986-55864008 GCACCACTGCACTTCAGTCTGGG + Intergenic
1041247415 8:55902048-55902070 GCACCATTGCAGTCCAGTCTGGG - Intronic
1041488799 8:58409601-58409623 GCACCATTGCACTTCAGCCTGGG - Intergenic
1041512293 8:58665184-58665206 GAACCATTACAGTGGAGTGGTGG - Intergenic
1041762791 8:61384956-61384978 AAACCATGGCAGTGCAGTGGTGG + Intronic
1041924340 8:63221286-63221308 GCACCACTGCAGTCCAGTCAGGG - Intergenic
1042229961 8:66545300-66545322 TCACCATTGCACTTCAGTCCAGG - Intergenic
1042275704 8:67003121-67003143 GCACCATTGCACTTCAGCCTGGG + Intronic
1042503833 8:69538733-69538755 GCACCATTGCACTTCAGCCTGGG - Intronic
1042545959 8:69951764-69951786 GCACCATTGCACTCCAGTCTGGG - Intergenic
1042905359 8:73766685-73766707 GCACCATTGCACTCCAGCGTGGG + Intronic
1043107049 8:76126783-76126805 GCACCATTGCACTCCAGTCTGGG + Intergenic
1043400976 8:79884053-79884075 GCACCATTGCACTCCAGTGTGGG - Intergenic
1043474042 8:80589339-80589361 GCACCATTGCACTCCAGTCTGGG - Intergenic
1043853894 8:85243646-85243668 GCACCATTGCACTCCAGCGTGGG + Intronic
1044856677 8:96482819-96482841 GCACCATTGCACTCCAGCCGGGG + Intergenic
1044987223 8:97766264-97766286 GCACCATTGCACTCCAGGGTAGG - Intergenic
1045454393 8:102362892-102362914 GCACCATTGCACTCCAGCTGGGG - Intronic
1045461640 8:102430887-102430909 GCACCATTGCACTCCAGTCTGGG - Intergenic
1046163926 8:110403971-110403993 GCACCACTGCACTCCAGTGTGGG + Intergenic
1046328579 8:112681822-112681844 GCACCATTGCATTCCAGTCTGGG + Intronic
1046350458 8:113003200-113003222 GCACCATTGCACTTCAGCCTGGG + Intronic
1046388843 8:113541263-113541285 GCACCACTGCACTCCAGTGTGGG - Intergenic
1046444476 8:114299059-114299081 GCACCACTGCACTCCAGTGTGGG - Intergenic
1046649426 8:116820672-116820694 GTACCAGAACAGTTCAGTGGAGG - Intronic
1046852230 8:118987519-118987541 GCACCACTGCAGTTCAGCCTGGG + Intergenic
1047241023 8:123088144-123088166 GCACCATTGCACTCCAGTGTGGG + Intronic
1047294135 8:123556376-123556398 GCACCATTGCACTCCAGTCTGGG - Intergenic
1047493644 8:125394235-125394257 GCACCATTGCACTCCAGTCTGGG - Intergenic
1047953121 8:129952086-129952108 GCACCATTGCACTTCAGCCTGGG - Intronic
1048192061 8:132298863-132298885 GCACCATTGCACTCCAGTCTGGG + Intronic
1048461433 8:134624612-134624634 GCACCATTGCATTCCAGTTTGGG + Intronic
1048942024 8:139408104-139408126 GCACCATTGCACTTCAGCCTGGG + Intergenic
1049089128 8:140500871-140500893 GCACCATTGCACTTCAGCCTGGG - Intergenic
1049873197 8:144998004-144998026 GCACCATTGCACTTCAGCCTGGG - Intergenic
1050366940 9:4881433-4881455 GCACCACTGCACTCCAGTGTGGG + Intronic
1050717000 9:8541270-8541292 GCACCATTGCAGTCCAGCCTGGG - Intronic
1050884918 9:10752020-10752042 GCACCACTGCAGTCCAGTCTGGG - Intergenic
1051037617 9:12767409-12767431 GCACCATTGCACTCCAGCGTGGG + Intergenic
1051057711 9:13007705-13007727 GCACCACTGCACTTCAGTCTGGG - Intergenic
1051077961 9:13262405-13262427 GCACCACTGCACTTCAGTCTGGG + Intronic
1051141251 9:13981570-13981592 GCACCACTGCACTTCAGCGTGGG - Intergenic
1051265270 9:15303673-15303695 GCACCATTGTACTCCAGCGGGGG - Intronic
1052832169 9:33224987-33225009 GCACCATTGCACTTCAGCCTGGG - Intronic
1052881902 9:33606082-33606104 GCACCATTGCACTCCAGTCGGGG - Intergenic
1052964145 9:34326307-34326329 ACACCACTGCAGTTCAGTGTGGG + Intronic
1053069885 9:35095044-35095066 TCACCAGTGCAGGTCAGTGTGGG - Exonic
1053430765 9:38040438-38040460 GCACCCATGCAGTGCAGTGGAGG + Intronic
1053708766 9:40783205-40783227 GCACCACTGCACTTCAGTCTGGG + Intergenic
1053797381 9:41738986-41739008 GCACCACTGCAGTTCAGCCTGGG + Intergenic
1053891105 9:42693925-42693947 GCACCATTGCACTTCAGCCTGGG - Intergenic
1054147810 9:61575948-61575970 GCACCACTGCAGTTCAGCCTGGG - Intergenic
1054185797 9:61951053-61951075 GCACCACTGCAGTTCAGCCTGGG + Intergenic
1054418676 9:64904000-64904022 GCACCACTGCACTTCAGTCTGGG + Intergenic
1054467552 9:65507035-65507057 GCACCACTGCAGTTCAGCCTGGG - Intergenic
1054652715 9:67637452-67637474 GCACCACTGCAGTTCAGCCTGGG - Intergenic
1054708246 9:68484495-68484517 ACACCATTGCACTTCAGCGTGGG + Intronic
1054791314 9:69259414-69259436 GCACCATTGCACTCCAGTCTGGG + Intergenic
1055010364 9:71558987-71559009 GCACCATTGCACTTCAGCCTGGG - Intergenic
1055032575 9:71785362-71785384 GCACCAGTGCACTCCAGTGTGGG - Intronic
1055044091 9:71907552-71907574 GCACCATTGCACTCCAGCGTGGG - Intronic
1055105455 9:72507357-72507379 GCACCATTGCACTCCAGTCTAGG - Intergenic
1055403881 9:75953892-75953914 GCCCCATTGAAGTCCTGTGGGGG + Intronic
1055455139 9:76465200-76465222 GCACCATTGCACTCCAGTCTGGG - Intronic
1055469839 9:76600593-76600615 GCACCACTGCAGTTCAGCCTGGG - Intergenic
1055558336 9:77498328-77498350 GCACCATTGCACTCCAGTCTGGG + Intronic
1055602855 9:77937847-77937869 GCACCATTGCACTCCAGTCTGGG + Intronic
1055955913 9:81773403-81773425 GCACCATTGCACTTCAGCCTAGG - Intergenic
1056085180 9:83141098-83141120 ACACCATTGCACTTCAGTCTGGG + Intergenic
1056186972 9:84144432-84144454 GCACCACTGCAGTCCAGCGTGGG + Intergenic
1056743333 9:89279036-89279058 GCACCACTGCACTCCAGTGTGGG + Intergenic
1056943877 9:90977441-90977463 CCAGCATTAGAGTTCAGTGGTGG + Intergenic
1056985833 9:91362886-91362908 GCACCATTGCACTCCAGTCCAGG + Intergenic
1057166189 9:92927845-92927867 GCACCATTGCACTCCAGCCGAGG + Intergenic
1057341222 9:94203345-94203367 GCACCACTGCACTTCAGTCTGGG + Intergenic
1057359061 9:94356894-94356916 GCACCATTGCACTCCAGTCTGGG - Intergenic
1057363426 9:94396470-94396492 GCACCATTGCACTTCAGCCTGGG + Intronic
1057391081 9:94641887-94641909 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1057412996 9:94834748-94834770 GCACCATTGCACTTCAGCCTGGG + Intronic
1057595848 9:96415843-96415865 GCACCACTGCACTTCAGTCTGGG - Intronic
1057648698 9:96900696-96900718 GCACCATTGCACTCCAGTCTGGG + Intronic
1057729431 9:97596029-97596051 ACACCATTGCACTTCAGTGTGGG + Intronic
1058220077 9:102288780-102288802 GCACCATTGCACTTCAGCCTGGG - Intergenic
1058711787 9:107685255-107685277 GCACCATTGCACTCCAGTCTGGG + Intergenic
1059648695 9:116293905-116293927 GCACCATTGCACTTCAGCCTGGG + Intronic
1059687072 9:116648042-116648064 GCACCATTGCACTCCAGTCTGGG - Intronic
1059812990 9:117877144-117877166 ACACCATTGCACTCCAGCGGGGG + Intergenic
1059855230 9:118389173-118389195 GCACCACTGCACTTCAGTCTGGG + Intergenic
1060127854 9:121067223-121067245 GCACCATTGCACTTCAGCCTGGG + Intergenic
1060164346 9:121397534-121397556 GCACCATTGCATTCCAGTCTGGG - Intergenic
1060450797 9:123737235-123737257 GCACCACTGCACTCCAGTGTGGG - Intronic
1060491764 9:124090490-124090512 GCACCATTGCACTTCAGCCTGGG - Intergenic
1061020949 9:128014352-128014374 GCACCATTGCACTCCAGTCTGGG - Intergenic
1061142768 9:128778499-128778521 GCACCATTGCACTCCAGTCTGGG + Intergenic
1061160268 9:128889843-128889865 GCACCATTGCACTCCAGTCTGGG - Intronic
1061167422 9:128931875-128931897 GCACCATTGCACTCCAGTCTGGG - Intronic
1061192946 9:129092767-129092789 GCACCATTGCACTTCAGCCTGGG + Intergenic
1061366781 9:130176233-130176255 GCACCATTGCACTCCAGTCAGGG - Intronic
1061456900 9:130705176-130705198 GCACCATTGCACTTCAGCCTAGG + Intergenic
1061460021 9:130730084-130730106 GCACCATTGCACTCCAGCGTGGG - Intronic
1061610807 9:131744421-131744443 TCACCATTGTAGATCAGAGGAGG + Intergenic
1061657684 9:132105236-132105258 GCACCATTGCACTTCAGCCTGGG + Intergenic
1061696295 9:132376703-132376725 GCACCACTGCACTTCAGCTGGGG - Intronic
1061777703 9:132976998-132977020 GCACCATTGCACTTCAGCCTGGG - Intronic
1062413742 9:136437754-136437776 GCACCATGGCAGTGGGGTGGGGG + Intronic
1062705509 9:137937902-137937924 GCACCATTGCACTCCAGCCGGGG + Intronic
1203531108 Un_GL000213v1:142932-142954 GCACCATTGCACTCCAGTCTGGG - Intergenic
1203751138 Un_GL000218v1:81534-81556 GCACCATTGCACTACAGTCTCGG + Intergenic
1203709826 Un_KI270742v1:87564-87586 GCACCATTGCACTACAGTCTGGG + Intergenic
1185533724 X:841181-841203 GCACCATTGCACTCCAGTGTGGG - Intergenic
1185548211 X:962712-962734 GCACCATTGCACTCCAGTCTGGG + Intergenic
1185608780 X:1381985-1382007 GCACCATTGCACTCCAGCCGGGG - Intronic
1185660031 X:1720100-1720122 GCACCACTGCAGTCCAGTCTGGG - Intergenic
1185849373 X:3470904-3470926 GCACCATTGCACTCCAGTCTGGG - Intergenic
1186078128 X:5902647-5902669 GCACCACTGCACTCCAGTGTGGG + Intronic
1186436136 X:9544603-9544625 GCACCATTGCACTTCAGCCTGGG - Intronic
1186488905 X:9956126-9956148 GCACCATTGCACTCCAGTCCGGG - Intergenic
1186740195 X:12508947-12508969 GCACCATTGCACTTCAGCCTGGG + Intronic
1186772260 X:12829664-12829686 GTACCAATGCACATCAGTGGAGG - Intergenic
1187004470 X:15218530-15218552 GCACCATTGCACTTCAGCCTGGG - Intergenic
1187072566 X:15902688-15902710 GCACCACTGCACTCCAGCGGAGG - Intergenic
1187153986 X:16706816-16706838 GCACCATTGCACTCCAGTCTGGG + Intronic
1187176465 X:16900284-16900306 GCACCACTGCACTCCAGTGTGGG + Intergenic
1187365753 X:18664755-18664777 GCACCACTGCACTCCAGTGTGGG - Intronic
1187377218 X:18766020-18766042 GCACCATTGCACTTCAGCCTGGG + Intronic
1187542816 X:20214879-20214901 GCACCATTGCACTCCAGCGTGGG - Intronic
1187744552 X:22394282-22394304 GCACCATTGCAGTCCAGCCTGGG + Intergenic
1187864470 X:23711277-23711299 GCGCCACTGCAGTCCAGTGTGGG + Intronic
1187920849 X:24199872-24199894 GCACCATTGCACTCCAGTCTGGG + Intronic
1188368880 X:29344678-29344700 GCACCATTGCACTTCAGCCTGGG - Intronic
1188546069 X:31308770-31308792 GCACCATTGCACTTCAGCCAGGG - Intronic
1188559732 X:31454179-31454201 GCACCATTGCACTCCAGCCGGGG - Intronic
1188951304 X:36378580-36378602 GCACCATTGCACTCCAGCTGGGG - Intronic
1189204586 X:39226846-39226868 GAGCCTTTGGAGTTCAGTGGAGG + Intergenic
1189302440 X:39961764-39961786 GCACCATTGCACTTCAGCCTGGG - Intergenic
1189327779 X:40123393-40123415 GCACCATTGCACTCCAGTCTGGG - Intronic
1189390578 X:40572957-40572979 GCACCATTGCACTTCAGCCTGGG + Intergenic
1189442594 X:41050505-41050527 GCACCAATGCAATCTAGTGGGGG + Intergenic
1189476755 X:41362129-41362151 GCACCATTGCACTCCAGTCTGGG - Intronic
1189476931 X:41363380-41363402 GCACCACTGCACTCCAGTGTGGG + Intronic
1189483622 X:41412102-41412124 GCACCACTGCAGTTCAGCCTGGG + Intergenic
1189486320 X:41435320-41435342 GCACCATTGCACTCCAGTCTGGG + Intergenic
1189492280 X:41479653-41479675 GCACCATTGCACTCCAGTCTGGG - Intergenic
1189638781 X:43044322-43044344 GCACCATTGCACTTCAGCCTGGG - Intergenic
1189698126 X:43686754-43686776 GCACCATTGCACTCCAGTCTGGG + Intronic
1189774879 X:44461594-44461616 GCACCATTGCACTTCAGCCTGGG + Intergenic
1189936185 X:46071182-46071204 GCACCATTGCACTTCAGCCTGGG - Intergenic
1189989910 X:46584492-46584514 GCACCATTGCACTCCAGTCTGGG + Intronic
1190018150 X:46846542-46846564 GCACCACTGCACTCCAGTGTGGG + Intronic
1190056556 X:47184679-47184701 TCACCATTGCAAACCAGTGGGGG + Intronic
1190238006 X:48632141-48632163 GAACCATTGGAGTCCACTGGAGG - Intergenic
1190468278 X:50749167-50749189 ACACCATTGCACTTCAGCGTGGG + Intronic
1190659219 X:52639441-52639463 GCACCATTGCACTCCAGTCTGGG - Intergenic
1190787243 X:53663468-53663490 GCACCATTGCACTCCAGTCTGGG + Intronic
1190835671 X:54098664-54098686 GCACCACTGCAGTTCAGCCTGGG - Intronic
1191645199 X:63472704-63472726 GCACCATTACACTTCAGTCTGGG - Intergenic
1192122339 X:68468224-68468246 GTAGCATTGCAGTTCAGTCTGGG + Intergenic
1192299865 X:69889188-69889210 GCACCACTGCACTTCAGTCTGGG - Intronic
1192342307 X:70274242-70274264 GCACCACTGCCCTCCAGTGGGGG - Intronic
1192408433 X:70910172-70910194 GCACCATTGCACTTCAGCCTGGG + Intergenic
1192445462 X:71207853-71207875 GCACCATTGCACTCCAGTCTGGG - Intergenic
1192497383 X:71625034-71625056 GCACCATTGCACTCCAGTCTGGG + Intergenic
1192677123 X:73209697-73209719 ACACCACTGCACTTCAGTGTGGG + Intergenic
1192762791 X:74111941-74111963 GCACCATTGCACTTCAGTCTGGG + Intergenic
1192949342 X:75999914-75999936 ACACCATTGCAGTCCAGCTGGGG + Intergenic
1193104180 X:77650625-77650647 GCACCATTGCACTTTAGTCTGGG - Intronic
1193274822 X:79572834-79572856 GCACCACTGCACTTCAGCGTGGG + Intergenic
1193812974 X:86073602-86073624 GCACCATTGCACTCCAGTCTGGG - Intergenic
1194507359 X:94749251-94749273 GCACCATTGCACTCCAGTCTGGG - Intergenic
1194645969 X:96458629-96458651 GCACCACTGCAGTCCAGTTTGGG + Intergenic
1195035431 X:100967556-100967578 GCACCATTGCACTTCAGCCTGGG + Intergenic
1195284901 X:103375208-103375230 GCACCACTGCACTTCAGTCTAGG - Intergenic
1195390729 X:104359419-104359441 GCTTCAATGCAGTTCACTGGAGG - Intergenic
1195663050 X:107400457-107400479 ACAACATTGCAATTCAGTGGGGG - Intergenic
1196237225 X:113296717-113296739 TCAGCATTCCAGTTCAATGGGGG + Intergenic
1196297542 X:114016023-114016045 GCACCATTGCACTCCAGCGTGGG + Intergenic
1196350035 X:114718063-114718085 GCACCACTGCACTTCAGTCTGGG - Intronic
1196371085 X:114980699-114980721 GCACCATTGCACTCCAGTCTGGG - Intergenic
1196434146 X:115659566-115659588 GCGCCATTGCACTCCAGCGGGGG + Intergenic
1196457380 X:115900059-115900081 GCACTATTGCTGTTTAGTGCAGG - Intergenic
1196679473 X:118455991-118456013 GCACCACTGCACTCCAGTGTGGG + Intergenic
1196680107 X:118461961-118461983 GCACCATTGCACTTCAGCCTAGG - Intergenic
1196792788 X:119479509-119479531 GCACCATTGCACTTCAGCCTGGG + Intergenic
1196800993 X:119543230-119543252 GCACCATTGCACTTCAGGCTGGG - Intronic
1196807473 X:119601338-119601360 GCACCATTGCACTTCAGCCTGGG + Intronic
1196833703 X:119795936-119795958 GCACCATTGCACTTCAGCCTGGG + Intergenic
1197199907 X:123739655-123739677 GCACCATTGCACTTCAGCCTGGG - Intergenic
1197354395 X:125418866-125418888 TCACCTCTGCTGTTCAGTGGAGG + Intergenic
1197526535 X:127570919-127570941 GCACCATTGCACTCCAGTCTGGG + Intergenic
1197929653 X:131681045-131681067 GCAGCATTTCAATTCTGTGGGGG - Intergenic
1198064953 X:133086869-133086891 ACACCACTGCACTTCAGTGTCGG + Intronic
1198194824 X:134349579-134349601 GCACCATTGCACTCCAGCGTGGG + Intergenic
1198205939 X:134464961-134464983 GCACCATTGCACTACAGTCTGGG - Intronic
1198269731 X:135044896-135044918 GCACCATTGCAATTCACTGGGGG - Intergenic
1198456768 X:136824924-136824946 GCACCATTGCACTTCAGCCTGGG - Intergenic
1198458799 X:136843474-136843496 GCACCATTGCAGTCCAGTCTGGG + Intergenic
1199311926 X:146330685-146330707 GCACCATTGCACTCCAGTCTGGG - Intergenic
1199909514 X:152271002-152271024 GCACCATTGCAGTCCAGCCTGGG - Intronic
1200224037 X:154407093-154407115 GCACCATTGCACTCCAGTCTGGG - Intronic
1200396319 X:155990791-155990813 GCACCATTGCACTCCAGTCTGGG - Intergenic
1200800748 Y:7385300-7385322 GCACCACTGCACTCCAGTGCAGG + Intergenic
1200801441 Y:7390669-7390691 ACACCATTGCAGTCCAGTCTGGG + Intergenic
1200876166 Y:8156875-8156897 GCACCATTGCACTCCAGCGTGGG - Intergenic
1201164793 Y:11199138-11199160 GCACCATTGCACTACAGTCTCGG + Intergenic
1201341400 Y:12937964-12937986 GCACCATTGCACTCCAGTCTGGG + Intergenic
1201341909 Y:12943184-12943206 GCACCATTGCACTCCAGTCTGGG + Intergenic
1201695756 Y:16823908-16823930 GCACCATTGCACTTCAGCCAGGG - Intergenic
1201888610 Y:18916476-18916498 GCGCCATTGCACTTCAGTCTGGG + Intergenic
1201912983 Y:19152444-19152466 GCACCATTGCACTGCAGTCTGGG - Intergenic
1201965407 Y:19728399-19728421 GCACCATTGCAGTCCAGCCTGGG - Intronic
1202056086 Y:20831729-20831751 GCTCCATTGCACTTCAGTGTGGG + Intergenic