ID: 980159461

View in Genome Browser
Species Human (GRCh38)
Location 4:129141888-129141910
Sequence ATCCATATGAATATACTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980159461_980159462 8 Left 980159461 4:129141888-129141910 CCTAGCAGTATATTCATATGGAT No data
Right 980159462 4:129141919-129141941 AATTCTATTCCAGCCACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980159461 Original CRISPR ATCCATATGAATATACTGCT AGG (reversed) Intergenic
No off target data available for this crispr