ID: 980159808

View in Genome Browser
Species Human (GRCh38)
Location 4:129146831-129146853
Sequence ATGATCCCCCAGCACCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980159804_980159808 23 Left 980159804 4:129146785-129146807 CCTGGGGCTTGAGGCTTACTAAT No data
Right 980159808 4:129146831-129146853 ATGATCCCCCAGCACCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980159808 Original CRISPR ATGATCCCCCAGCACCATCA GGG Intergenic
No off target data available for this crispr