ID: 980162131

View in Genome Browser
Species Human (GRCh38)
Location 4:129177552-129177574
Sequence CTGCATGAAGAGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980162129_980162131 -10 Left 980162129 4:129177539-129177561 CCTTTATTCAATACTGCATGAAG 0: 1
1: 0
2: 1
3: 7
4: 182
Right 980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG 0: 1
1: 0
2: 3
3: 21
4: 340
980162128_980162131 -9 Left 980162128 4:129177538-129177560 CCCTTTATTCAATACTGCATGAA 0: 1
1: 0
2: 1
3: 27
4: 289
Right 980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG 0: 1
1: 0
2: 3
3: 21
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980162131 Original CRISPR CTGCATGAAGAGATTGAGGA TGG Intergenic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
902200645 1:14830977-14830999 CAGCATGAAGAGGTAGAGAAGGG - Intronic
902567433 1:17321353-17321375 CTTCATAAAGAGAGTGAGGGTGG - Intronic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
903291992 1:22319807-22319829 CTGCAGGAAGAGAGAGAGGGAGG + Intergenic
903542219 1:24102966-24102988 CTGCCTGATGTGATTGATGATGG + Intronic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
904776586 1:32912164-32912186 CTGGATGAAGGGAGTGATGACGG - Intergenic
904806783 1:33137773-33137795 CAGAATGATGAGACTGAGGAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905524100 1:38623608-38623630 CTGCATGAAGTGACTGAGCCAGG + Intergenic
906276415 1:44519695-44519717 CTACATGGAGAGATGGAGGGAGG - Intronic
907118248 1:51988632-51988654 ATGGATGAAGAAATTGAGGCAGG + Intronic
907717980 1:56945525-56945547 GTGCAGGAAGAGATCCAGGATGG + Intronic
908070073 1:60450676-60450698 CTCCATGAAGAGAAAAAGGAGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908480127 1:64531363-64531385 AGGCTTGAAGAGATTGAGAAGGG + Intronic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
911525074 1:98974565-98974587 CTTCGTGAAGAGAGTGGGGATGG - Intronic
912577454 1:110686408-110686430 CCACATGCAGAGGTTGAGGAAGG - Intergenic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
913275993 1:117138192-117138214 CAGCATGTAGAGATGGCGGAAGG - Intergenic
913475641 1:119234692-119234714 CTGCAGGAAGAAATGAAGGAAGG - Intergenic
914926442 1:151892879-151892901 CAACATGAAGGGTTTGAGGATGG + Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
919790755 1:201289344-201289366 CAGCATGAAAAGCTTGAGAAAGG - Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920791298 1:209095517-209095539 TAGCATGAAAAGATTGGGGAAGG + Intergenic
922883335 1:228999119-228999141 CTGCTTCATGTGATTGAGGATGG - Intergenic
923903074 1:238350550-238350572 CTGACTGAAGGGATTGGGGAAGG - Intergenic
924146931 1:241086253-241086275 CTTCATGGAGAGAATGACGAAGG - Intronic
1062813910 10:485310-485332 CTGCGAGAAGAGAATGAGGGAGG + Intronic
1064247419 10:13680108-13680130 CTCCAGGAAGAAATTGAGGCAGG + Intronic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1067130606 10:43561164-43561186 CTGCATGAGGACAGTGAAGATGG + Intronic
1067930723 10:50558722-50558744 CAACATGAAGACAATGAGGATGG + Intronic
1068122105 10:52791733-52791755 CAACATGAAGACAATGAGGATGG - Intergenic
1069177915 10:65316963-65316985 CTGCACAAAGAAAATGAGGAAGG + Intergenic
1069652683 10:70061275-70061297 GTGGATGAATAGATTCAGGAAGG + Intronic
1069845729 10:71369894-71369916 CTGCCTTAAAAGATTGAGAAGGG + Intergenic
1069950343 10:72014367-72014389 CTGCAGGAAGAGGCAGAGGAGGG + Intergenic
1071093492 10:81947181-81947203 CGGCATGAAGAGACTCAGGGTGG - Intronic
1071229509 10:83569041-83569063 GTACATGAACACATTGAGGAAGG + Intergenic
1071430564 10:85603280-85603302 CTGCCTGAAGAGATTGCACAGGG - Intronic
1073314505 10:102569504-102569526 CTGCTTGGAGAGATAGAGAAGGG - Intronic
1074008491 10:109453199-109453221 CTGGATGGTGAAATTGAGGAGGG - Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1075806360 10:125191868-125191890 CTGCATGATGAAATTATGGATGG + Intergenic
1076445581 10:130511744-130511766 GGGAAAGAAGAGATTGAGGAGGG + Intergenic
1078127726 11:8584842-8584864 CTATATGAAGACAATGAGGAAGG + Intronic
1078337492 11:10475559-10475581 CTGCATCTGGAGATTAAGGAGGG - Intronic
1078606251 11:12778434-12778456 CTGCCTGTGGAGATTAAGGAAGG - Intronic
1079252043 11:18793521-18793543 CTGCATGGAGAAAATGAGGAGGG - Intergenic
1080027327 11:27628232-27628254 CTGCATAAAGATACAGAGGAAGG - Intergenic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081717398 11:45260116-45260138 CTGGATGCAGAGATTCAAGAGGG - Intronic
1082177915 11:49082912-49082934 CTGCAAGAAGGGTTTGGGGAGGG + Intergenic
1082898841 11:58223532-58223554 CTGGATGAAGGGAATGAGCAGGG + Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083457731 11:62790183-62790205 CTGCAGGAAGAGGTGGAGGGGGG - Exonic
1084815553 11:71643945-71643967 GTGCATGAGGGGATGGAGGATGG - Intergenic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085612051 11:77959454-77959476 CAGCATCAAGGGAGTGAGGATGG - Intronic
1086439744 11:86816192-86816214 CTAATTGAAGAGATGGAGGAAGG - Intronic
1086687803 11:89752948-89752970 CTGCAAGAAGGGTTTGGGGAGGG - Intergenic
1086718048 11:90086946-90086968 CTGCAAGAAGGGTTTGGGGAGGG + Intergenic
1088053181 11:105543760-105543782 CTGCATGAAAAGATTTATGAAGG + Intergenic
1088343966 11:108801646-108801668 CTTCATAAAGAATTTGAGGATGG + Intronic
1088423642 11:109676171-109676193 TTCCAGGAAGTGATTGAGGAGGG - Intergenic
1089047625 11:115517015-115517037 CTCTATGAAGGAATTGAGGAAGG + Intergenic
1089220878 11:116870398-116870420 CTGCCTGAAGAGAGACAGGAAGG + Exonic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1092427458 12:8386109-8386131 GTGCATGAGGGGATGGAGGATGG + Intergenic
1095314569 12:40744344-40744366 ATGCATGAAGGGAATGAGGGTGG + Intronic
1096274844 12:50197657-50197679 CAGCATGAAGACAATGACGAAGG + Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097996433 12:65892740-65892762 CAGGATGAATGGATTGAGGACGG - Intronic
1098725113 12:73954646-73954668 CTTTATGAAGAGTTTGAGGAAGG - Intergenic
1098939102 12:76514491-76514513 AAGCCAGAAGAGATTGAGGAGGG - Intronic
1101015828 12:100499040-100499062 AAGCATGAAGAGGCTGAGGAGGG - Intronic
1101842906 12:108340701-108340723 CTGAATTAAAGGATTGAGGATGG - Intergenic
1102183722 12:110932043-110932065 CTGCTCGTAGAGTTTGAGGATGG + Intergenic
1102485528 12:113252774-113252796 CCACATGAGCAGATTGAGGACGG + Intronic
1103419743 12:120770812-120770834 CTCCAAGAAGAGATTCAGGCTGG - Intronic
1105296612 13:19092059-19092081 CTGAAGGAGGAGCTTGAGGAAGG - Intergenic
1105881785 13:24612352-24612374 CAGCCTGGAAAGATTGAGGAAGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1110398877 13:75066285-75066307 AGGCATAAAGAGATGGAGGATGG + Intergenic
1110579070 13:77097747-77097769 CTGCATGAAAAATGTGAGGATGG - Exonic
1112567103 13:100561092-100561114 CTGCTTGATGAGACTTAGGAGGG - Intronic
1113172598 13:107522309-107522331 CTATATGGAGAGATTGAGAAAGG - Intronic
1114638771 14:24205103-24205125 TTGTATGTAGGGATTGAGGAAGG + Intronic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1116107226 14:40525501-40525523 CTGCATCAGGTGATTGAGCAAGG - Intergenic
1116161530 14:41271778-41271800 CTGCATGTAGAGAATGAATATGG - Intergenic
1116362076 14:44012490-44012512 TTCCATGAAAAGATTCAGGAAGG - Intergenic
1117287173 14:54297442-54297464 CTTCATGTAGAAATTGAGGGTGG - Intergenic
1122449498 14:101793761-101793783 TTGCATGAAGGAATTGAAGATGG + Intronic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1124155530 15:27222068-27222090 CTCCAGGAAGAAAATGAGGAGGG - Intronic
1126845911 15:52760522-52760544 CTGCTTGAAGATATTCAGGAAGG + Intronic
1127340848 15:58042255-58042277 CTGTATGAAGGGATTTAGGAAGG - Intronic
1127573681 15:60269184-60269206 CTTCATGGAGTGATTTAGGAAGG + Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127871760 15:63079932-63079954 CTGCATGAAAAGTTTTAGTATGG + Intergenic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128528344 15:68427754-68427776 CTGCATGATGGGGTTGTGGAGGG + Intronic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1130252456 15:82308780-82308802 CAACATGAAGAGGATGAGGATGG - Intergenic
1131234277 15:90682607-90682629 CTGCATCAAGAGACAGATGAAGG - Intergenic
1131938332 15:97532814-97532836 ATCCTTAAAGAGATTGAGGAAGG + Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1133370790 16:5244269-5244291 GTGCATGAGGGGATGGAGGATGG - Intergenic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136558187 16:31021417-31021439 CTGCATAAAGAAATTCTGGAAGG - Intergenic
1138272276 16:55703835-55703857 CTGCATGAAGAGGATTATGAGGG + Intronic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139225262 16:65228403-65228425 CAGCATGAAGGAATTGAGTAGGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140654308 16:77123920-77123942 ATGGATGAAGAGATAGTGGAAGG + Intergenic
1141070348 16:80948778-80948800 GTGAAGGAAGAGATTGTGGAAGG + Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1144087551 17:11824323-11824345 CTGAATCAAGAAATTGAAGAGGG - Intronic
1145068470 17:19781550-19781572 GTGCATTAAGAAATTAAGGAGGG - Intronic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1146517952 17:33503954-33503976 CAACATGAAGAGAATGGGGAAGG + Intronic
1147415778 17:40288528-40288550 CTACATGAAGAGGCTGAGGCAGG - Intronic
1149372981 17:56013828-56013850 CTCCATGAATAGATTGAAGTAGG + Intergenic
1149761096 17:59230995-59231017 CTCCTTGAAGACAGTGAGGAAGG - Intronic
1151354921 17:73552702-73552724 CTGACTGCAGAGCTTGAGGACGG + Intronic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1156014465 18:32532472-32532494 GTGCTTGAGGGGATTGAGGAAGG + Intergenic
1156614394 18:38766410-38766432 CTACATGAAAAGAGTGAGGGTGG - Intergenic
1156837075 18:41567264-41567286 AGGCCTGAAGAGATGGAGGAAGG + Intergenic
1157697171 18:49732170-49732192 CTGAATGATGAGAGTGAGGCTGG + Intergenic
1159854503 18:73568100-73568122 CTGCAATAGGAGATTGATGATGG - Intergenic
1160389904 18:78522083-78522105 CTGGATGGGGAGGTTGAGGATGG - Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161083207 19:2321695-2321717 CTGGATGAAGGGGTTGGGGATGG + Exonic
1161595768 19:5150352-5150374 CTGCAGGTGGAGTTTGAGGACGG + Exonic
1162823015 19:13234790-13234812 CTGCCAGAAGAGAAGGAGGAGGG + Intronic
1162823704 19:13238137-13238159 ATGCAGGAAGAGATGGAGGGTGG - Intronic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1165746445 19:38232708-38232730 CAGCATGAAGAGAATCAGGTGGG + Intergenic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166794969 19:45420486-45420508 GTGCAAGAAGAGGTGGAGGAGGG - Intronic
1166993375 19:46706440-46706462 CTGCAAGAAGAGCTTCAGCAGGG + Intronic
1167144321 19:47672835-47672857 CTGAATGATGAGGATGAGGATGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167325092 19:48819505-48819527 TTGCAAGAAGAGATTGGGGTGGG - Intronic
1167516878 19:49928846-49928868 CTGCGGGAAGAGAATGAGGCTGG + Exonic
925649302 2:6072377-6072399 CTGCACGCAGAGATTTAGGGAGG + Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
930207615 2:48603726-48603748 CAGCATGAAGACATTCATGAGGG + Intronic
931335722 2:61341477-61341499 CAGCATGAAGACATTCATGAGGG - Intronic
931570565 2:63664957-63664979 CTGCATGGAGAGGATGAAGATGG + Intronic
933400376 2:81788858-81788880 CTACATGAAGACATTCAGCAAGG - Intergenic
934582036 2:95450468-95450490 CTGCAAGAAGGGTTTGGGGAGGG - Intergenic
934597414 2:95626246-95626268 CTGCAAGAAGGGTTTGGGGAGGG + Intergenic
934842474 2:97636748-97636770 CTGCAAGAAGGGTTTGGGGAGGG - Intergenic
935129384 2:100249915-100249937 ATGCAGGAAGAAATTCAGGAAGG - Intergenic
936717352 2:115203464-115203486 CAGCATGAACAGATTGGAGAGGG + Intronic
937271542 2:120656068-120656090 CTGGAAGATGAGATTGTGGATGG + Intergenic
938884140 2:135625700-135625722 CTGGATGAGGAGATTGGTGAAGG + Intronic
939036874 2:137142927-137142949 CTGCATGAATAGATTGAGGGAGG - Intronic
939963035 2:148583016-148583038 CTAAATGAAGAAATTAAGGAAGG + Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
940176711 2:150885499-150885521 CTCCATGACTAGATTGGGGAAGG + Intergenic
940180962 2:150932218-150932240 CTCCAAGAAGTGCTTGAGGAGGG + Intergenic
941860472 2:170273719-170273741 CTGCTTGACGGGTTTGAGGAAGG - Intronic
942072899 2:172331316-172331338 CTTCATGGAGAAATTGAGGAGGG + Intergenic
942621421 2:177847941-177847963 TTGCATGAGGAGATTGATAAGGG - Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944314063 2:198266681-198266703 ATGCCTGAAGGGAGTGAGGATGG + Intronic
944595253 2:201255322-201255344 GCGCTTGAAGAGATTGAGGTAGG - Intronic
946029491 2:216693420-216693442 CTGGTTTAAGAGATTGGGGAGGG + Intronic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
947650083 2:231780031-231780053 ATGCATGAAGAGATTAAAGTTGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169373284 20:5044964-5044986 CTCCAAGAAGGGAGTGAGGAAGG - Intergenic
1169827898 20:9789994-9790016 ATGCTTGAAGACATTGAGGAGGG + Intronic
1170121907 20:12921366-12921388 CTTCAGGAAGAGATAGAGGGAGG + Intergenic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1173431641 20:42992827-42992849 CTACATGAAGAGAGTGAGAGAGG - Intronic
1173917914 20:46723310-46723332 CTCCAAGAAGAGGGTGAGGAGGG - Intronic
1175108983 20:56632553-56632575 CTGCTTAAATGGATTGAGGATGG + Intronic
1175441015 20:58991325-58991347 CTGCATGAACAGGTCCAGGAAGG - Exonic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1177310538 21:19386676-19386698 CTACATGAATATTTTGAGGAGGG - Intergenic
1178670358 21:34584877-34584899 TTACATGAAGCGATTAAGGACGG - Intronic
1180024918 21:45155630-45155652 ATGCATGGAGAGATGGATGATGG - Intronic
1180575096 22:16766193-16766215 CTGGGAGAAGAGATTAAGGAAGG + Intergenic
1181686735 22:24534351-24534373 CTGAATGAAGAGGTGTAGGAAGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182510414 22:30815767-30815789 GAGCATGAAAAGATAGAGGATGG - Intronic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1184268546 22:43364058-43364080 CTGCATTCAGAGCTTGGGGAAGG + Intergenic
1184335367 22:43849689-43849711 CTGCATGAACGAATTGAAGATGG - Intronic
1184885774 22:47343716-47343738 CTGCATGCAGGGACTGAGTAGGG - Intergenic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
949387775 3:3523041-3523063 CTACATGATGAAATTGAGAAGGG - Intergenic
950387560 3:12672188-12672210 CGGCATGGAGAGAATGATGAAGG + Intergenic
950675241 3:14550601-14550623 ATGCATGAGGAGATTGAGGCCGG - Intergenic
953495991 3:43387407-43387429 CGGCAGGGAGAGCTTGAGGAGGG + Intronic
953916958 3:46926490-46926512 CTGCCTGAAAAGACTGAGGCAGG - Intronic
954778012 3:53037193-53037215 CTGCAGCAAGTGCTTGAGGAGGG - Intronic
955109028 3:55929375-55929397 CTGCTTGGAGAAATTGAGAAGGG - Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
958502458 3:94930967-94930989 CTTCAAGAGGAGATTGAAGAGGG - Intergenic
959040311 3:101414721-101414743 ATGAATGAAGAAATTAAGGATGG + Intronic
959941854 3:112088537-112088559 CTGAGTGAAGAAATTGAGGGAGG + Intronic
960651335 3:119953847-119953869 CTGCAGGGAGAGATTGGTGATGG - Intronic
960725335 3:120664211-120664233 AGGCATGAAGAGCTTGGGGAAGG + Intronic
960744364 3:120870294-120870316 GTGGATGGAGAGGTTGAGGAAGG - Intergenic
961281975 3:125771282-125771304 GTGCATGAGGGGATGGAGGATGG - Intergenic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
962317631 3:134368670-134368692 CTACTAGAAGAGATGGAGGATGG - Intronic
963134261 3:141886296-141886318 CAGAACGAAGAGATTGGGGAAGG - Intronic
963999874 3:151757472-151757494 GTTCATGAACATATTGAGGATGG + Exonic
964322439 3:155512203-155512225 CTACATAAAGAGAGTGAGAATGG - Intronic
965476668 3:169164122-169164144 CTACAAGATGAGATTTAGGAGGG - Intronic
965699062 3:171440709-171440731 CTGCAGGAAGAGGGTGTGGAGGG + Intronic
966596216 3:181726516-181726538 CTGCCTGAAGAGGATGAGGGTGG - Intergenic
967841975 3:194012899-194012921 GTGCATGAAGACAATGAAGAAGG - Intergenic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969738208 4:9005237-9005259 GCGCATGAAGGGATGGAGGATGG - Intergenic
973721006 4:53723718-53723740 CTGCAAGATGAGAATGAGAAGGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
973861992 4:55074819-55074841 CTGCATGATGTGATTAAGAAAGG + Intergenic
973865034 4:55104107-55104129 CTGCATGAAGAGTGGGATGATGG - Intronic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
975512776 4:75211710-75211732 CTAAATGTAGAAATTGAGGAGGG - Intergenic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
976978437 4:91193011-91193033 TTGCATGTATAGTTTGAGGAAGG - Intronic
977952597 4:102990770-102990792 GTGCATGGACACATTGAGGAAGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979324399 4:119361899-119361921 TTGCATGACGGGATGGAGGAAGG + Intergenic
979826237 4:125236319-125236341 CTCTATGACGAGATTCAGGAAGG + Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
982951453 4:161702259-161702281 CTGCATGAAGATGATGAGAAGGG + Intronic
983922254 4:173358514-173358536 CTGCATGAAGCACTGGAGGAGGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
990315923 5:54583343-54583365 CTGAATGAAAACATTGAGCATGG + Intergenic
991336913 5:65559097-65559119 ATGAATAAAGATATTGAGGAGGG - Intronic
991473781 5:66998635-66998657 GGGAAAGAAGAGATTGAGGATGG - Intronic
992504719 5:77375615-77375637 CTGCAGGAGGACATTAAGGAGGG - Intronic
992762667 5:79964863-79964885 CTCAAGGAAGAGATTGAGGCTGG - Intergenic
992826142 5:80552120-80552142 GTGCATGGAGAGAGAGAGGAAGG + Intergenic
992954667 5:81894968-81894990 CTCCAAGAAGAAACTGAGGATGG - Intergenic
993548370 5:89242259-89242281 AAGCATGAAGATATTGAGGTAGG + Intergenic
993724614 5:91353685-91353707 CACCATGAATAGTTTGAGGATGG - Intergenic
993965668 5:94357293-94357315 CTACATGAAAGGCTTGAGGATGG - Intronic
995283504 5:110360881-110360903 GTGCATAAAGAGTCTGAGGATGG - Intronic
995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG + Intergenic
996197048 5:120621534-120621556 ATTCATGAAGAGATTTAGGTTGG - Intronic
997835783 5:137192301-137192323 CTGCATGGAGAGACGGAGGGAGG + Intronic
997839188 5:137223142-137223164 GGGCAGGAAGAGACTGAGGATGG + Intronic
998444691 5:142189482-142189504 CTGAATGAAGTGACAGAGGAAGG - Intergenic
999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG + Intergenic
1000287593 5:159840150-159840172 CATCATGAAGAGCTTGAGAATGG - Intergenic
1000650741 5:163815372-163815394 CTGCATGCTGAGGTTGGGGATGG - Intergenic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1001730909 5:173956201-173956223 CAGCGTGAAGAGGTTGAGGAAGG - Exonic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003464224 6:6363046-6363068 CTGCATGAAGAGTTTGAGAAAGG - Intergenic
1003790886 6:9546179-9546201 CTGTATGAAGAGAATGTGAAAGG + Intergenic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1004914068 6:20315171-20315193 GGGCATGAAGAGATACAGGAGGG + Intergenic
1006811262 6:36821931-36821953 TTGCATGAACAGACTGAAGATGG - Intronic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010010113 6:71039173-71039195 ATTCATTAAGTGATTGAGGATGG + Intergenic
1010302954 6:74282765-74282787 ATGAATGAAGAAATTAAGGATGG + Intergenic
1010786093 6:80003662-80003684 ATGCATTAAGTGATTGAGAAGGG + Intergenic
1011532654 6:88340330-88340352 ATACATAAAGAGTTTGAGGAAGG + Intergenic
1011806475 6:91078419-91078441 CTGCATGAAGGCCTTGAGGCAGG + Intergenic
1014136563 6:117896387-117896409 CGGCATCAAGACATTGATGAAGG - Intergenic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015938756 6:138428636-138428658 TTGCATGAAGAGTTTCAGGTAGG + Intronic
1016441657 6:144090179-144090201 CTGCATGAGGGCATTGAGAAAGG - Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017492262 6:154955077-154955099 CCGCATGGAGAGATCAAGGATGG + Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1019321137 7:415839-415861 CAGCATGAGGAGTTTCAGGAAGG - Intergenic
1021579046 7:22133077-22133099 CTGCCTGAAGGGAGTGAGGAGGG - Intronic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022176044 7:27872861-27872883 CTGCATAAAAAGATAGGGGATGG + Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1022949660 7:35324419-35324441 CTGCATGAAGTGACTTGGGAAGG + Intergenic
1023188307 7:37553633-37553655 CTGCAAGATGAGATTTAGGTGGG + Intergenic
1023284890 7:38608697-38608719 CTGCAAGAAGTGATGGTGGAAGG + Intronic
1023827090 7:44016942-44016964 TGGGATGAAGAGATTGAGAAAGG - Intergenic
1024442993 7:49443251-49443273 CTGCATGGAGAGGTTCAGGGAGG - Intergenic
1025272821 7:57540958-57540980 CTCCATGAAGAGACTAAGGATGG - Intergenic
1025841036 7:65149607-65149629 CAGCATCAAGGGAGTGAGGATGG + Intergenic
1025882009 7:65546341-65546363 CAGCATCAAGGGAGTGAGGATGG - Intergenic
1025891432 7:65656291-65656313 CAGCATCAAGGGAGTGAGGATGG + Intergenic
1026875606 7:73877369-73877391 CTGCATGGGGAGACTGAGGCAGG + Intergenic
1026903385 7:74049223-74049245 CTGCATGGAGGAATGGAGGATGG - Intronic
1028519651 7:91716032-91716054 CTTTATGGAGAGATTAAGGAGGG + Intronic
1029074424 7:97924758-97924780 GTGCATGAGGGGATGGAGGATGG + Intergenic
1029738245 7:102476688-102476710 TGGGATGAAGAGATTGAGAAAGG - Intronic
1029755375 7:102570344-102570366 TGGGATGAAGAGATTGAGAAAGG - Intronic
1029773324 7:102669424-102669446 TGGGATGAAGAGATTGAGAAAGG - Intronic
1029853481 7:103489302-103489324 CTGCTGGAAGAGGCTGAGGAAGG + Intronic
1031714710 7:125094595-125094617 CTACAAGCAGAGTTTGAGGAGGG + Intergenic
1032114270 7:129103582-129103604 CAGCATGAAGAAAAAGAGGAAGG - Intergenic
1032184985 7:129716989-129717011 TTGCATGAAGAAATTCTGGAAGG - Intronic
1036426476 8:8649574-8649596 CTGAAAGAAGAGATTGATGCTGG - Intergenic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1040776077 8:51044674-51044696 CTGGATGATGAGATAGAGGATGG - Intergenic
1041876861 8:62698398-62698420 CTGCAGGAGGAGCTTGAGTAGGG - Intronic
1043472271 8:80574921-80574943 AGGAATGAAGAGATTGGGGAGGG - Intergenic
1046600377 8:116310001-116310023 CTTCATGAAGAGAGTAAGAAGGG - Intergenic
1046783761 8:118243869-118243891 CTGCATGAAGAGAGAGAAAATGG + Intronic
1047021313 8:120777594-120777616 CTTCATGAAGCCAGTGAGGAAGG - Intronic
1047034575 8:120923082-120923104 ATGCATTAATAGATTGAGGGTGG + Intergenic
1047921950 8:129644448-129644470 CTGAATGAAGTGATTGTGGCTGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048500132 8:134967949-134967971 CTACATGCAGAGATTGTGAAAGG - Intergenic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049818340 8:144618946-144618968 CTGCAGGACGAGGATGAGGACGG - Intergenic
1051262210 9:15275637-15275659 CTTCATCAGGAGATAGAGGAAGG + Intronic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1053450714 9:38192094-38192116 CTGGATGAAGAGAGTGAGTGTGG + Intergenic
1055819452 9:80244407-80244429 CTGTATAAAGAGAGTAAGGATGG + Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056974879 9:91243559-91243581 CTGCAAGATAAGATTGAGGTGGG - Intronic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1058725517 9:107799808-107799830 CTGGCTGAAGAAGTTGAGGATGG + Intergenic
1061488226 9:130931054-130931076 CTCTGTGAAGAGATAGAGGAAGG - Intronic
1061586150 9:131570101-131570123 CAGCATGAAGAGACACAGGATGG - Intergenic
1062063865 9:134515408-134515430 CTACAAGATGAGATTGAGAAGGG - Intergenic
1062227939 9:135464373-135464395 CTGCGTGAAGGGCTTTAGGAAGG - Intergenic
1185870109 X:3657791-3657813 CAGCAATGAGAGATTGAGGAAGG + Intronic
1186929972 X:14378418-14378440 CTGCTTGAGGAGTTTAAGGATGG + Intergenic
1187269733 X:17768898-17768920 ATGAATGAAGAAATTAAGGATGG - Intergenic
1187808635 X:23150304-23150326 CTGCATGAAGACTTTGACAATGG - Intergenic
1188129145 X:26408984-26409006 CTACATGAATAGATTGTGTAGGG - Intergenic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1195810889 X:108828146-108828168 GTGCATGAAGAGTTAGAAGATGG + Intergenic
1196068710 X:111495343-111495365 CTGCCTGAAGAAATTAGGGATGG - Intergenic