ID: 980163978

View in Genome Browser
Species Human (GRCh38)
Location 4:129201916-129201938
Sequence TTGCCTACACAATCCTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980163977_980163978 -9 Left 980163977 4:129201902-129201924 CCTCTGTTTCAACTTTGCCTACA No data
Right 980163978 4:129201916-129201938 TTGCCTACACAATCCTATCAAGG No data
980163976_980163978 27 Left 980163976 4:129201866-129201888 CCTACTTCTATGATGCAAAGAAA No data
Right 980163978 4:129201916-129201938 TTGCCTACACAATCCTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980163978 Original CRISPR TTGCCTACACAATCCTATCA AGG Intergenic
No off target data available for this crispr