ID: 980164560

View in Genome Browser
Species Human (GRCh38)
Location 4:129209664-129209686
Sequence TTCCTCCAACTCTAGATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980164560_980164562 18 Left 980164560 4:129209664-129209686 CCAAACATCTAGAGTTGGAGGAA No data
Right 980164562 4:129209705-129209727 AATTTCCCAGTTGATAACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980164560 Original CRISPR TTCCTCCAACTCTAGATGTT TGG (reversed) Intergenic
No off target data available for this crispr