ID: 980173164 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:129313486-129313508 |
| Sequence | AGAGAGAAGCCCAATTAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 980173164_980173168 | 19 | Left | 980173164 | 4:129313486-129313508 | CCCTCCTAATTGGGCTTCTCTCT | No data | ||
| Right | 980173168 | 4:129313528-129313550 | TCTTTGTTTAGGTATAACTCAGG | No data | ||||
| 980173164_980173169 | 26 | Left | 980173164 | 4:129313486-129313508 | CCCTCCTAATTGGGCTTCTCTCT | No data | ||
| Right | 980173169 | 4:129313535-129313557 | TTAGGTATAACTCAGGTCCTTGG | No data | ||||
| 980173164_980173167 | 8 | Left | 980173164 | 4:129313486-129313508 | CCCTCCTAATTGGGCTTCTCTCT | No data | ||
| Right | 980173167 | 4:129313517-129313539 | TTTTTGCTTCTTCTTTGTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 980173164 | Original CRISPR | AGAGAGAAGCCCAATTAGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||