ID: 980173164

View in Genome Browser
Species Human (GRCh38)
Location 4:129313486-129313508
Sequence AGAGAGAAGCCCAATTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980173164_980173168 19 Left 980173164 4:129313486-129313508 CCCTCCTAATTGGGCTTCTCTCT No data
Right 980173168 4:129313528-129313550 TCTTTGTTTAGGTATAACTCAGG No data
980173164_980173169 26 Left 980173164 4:129313486-129313508 CCCTCCTAATTGGGCTTCTCTCT No data
Right 980173169 4:129313535-129313557 TTAGGTATAACTCAGGTCCTTGG No data
980173164_980173167 8 Left 980173164 4:129313486-129313508 CCCTCCTAATTGGGCTTCTCTCT No data
Right 980173167 4:129313517-129313539 TTTTTGCTTCTTCTTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980173164 Original CRISPR AGAGAGAAGCCCAATTAGGA GGG (reversed) Intergenic
No off target data available for this crispr