ID: 980176867

View in Genome Browser
Species Human (GRCh38)
Location 4:129356460-129356482
Sequence CATCAGAAGGAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980176867_980176872 30 Left 980176867 4:129356460-129356482 CCCTCCTCTTTCTCCTTCTGATG No data
Right 980176872 4:129356513-129356535 CTCATTAGACACTTCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980176867 Original CRISPR CATCAGAAGGAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr