ID: 980186295

View in Genome Browser
Species Human (GRCh38)
Location 4:129465123-129465145
Sequence TAGGATGCCCACAGTGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980186295_980186304 19 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186304 4:129465165-129465187 AGAGTCTTAAGTTCTGGGGGTGG No data
980186295_980186301 14 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186301 4:129465160-129465182 AAGCAAGAGTCTTAAGTTCTGGG No data
980186295_980186305 20 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186305 4:129465166-129465188 GAGTCTTAAGTTCTGGGGGTGGG No data
980186295_980186303 16 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186303 4:129465162-129465184 GCAAGAGTCTTAAGTTCTGGGGG No data
980186295_980186309 24 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186309 4:129465170-129465192 CTTAAGTTCTGGGGGTGGGGGGG No data
980186295_980186302 15 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186302 4:129465161-129465183 AGCAAGAGTCTTAAGTTCTGGGG No data
980186295_980186308 23 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186308 4:129465169-129465191 TCTTAAGTTCTGGGGGTGGGGGG No data
980186295_980186310 28 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186310 4:129465174-129465196 AGTTCTGGGGGTGGGGGGGCAGG No data
980186295_980186300 13 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186300 4:129465159-129465181 AAAGCAAGAGTCTTAAGTTCTGG No data
980186295_980186306 21 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186306 4:129465167-129465189 AGTCTTAAGTTCTGGGGGTGGGG No data
980186295_980186307 22 Left 980186295 4:129465123-129465145 CCCAATCCACTGTGGGCATCCTA No data
Right 980186307 4:129465168-129465190 GTCTTAAGTTCTGGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980186295 Original CRISPR TAGGATGCCCACAGTGGATT GGG (reversed) Intergenic
No off target data available for this crispr