ID: 980187183

View in Genome Browser
Species Human (GRCh38)
Location 4:129476649-129476671
Sequence AAATTTAGGCAGCATATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980187180_980187183 18 Left 980187180 4:129476608-129476630 CCACAATGATCCTTTGTATTTAA No data
Right 980187183 4:129476649-129476671 AAATTTAGGCAGCATATCTCTGG No data
980187179_980187183 19 Left 980187179 4:129476607-129476629 CCCACAATGATCCTTTGTATTTA No data
Right 980187183 4:129476649-129476671 AAATTTAGGCAGCATATCTCTGG No data
980187181_980187183 8 Left 980187181 4:129476618-129476640 CCTTTGTATTTAAGAGAGCTCAG No data
Right 980187183 4:129476649-129476671 AAATTTAGGCAGCATATCTCTGG No data
980187178_980187183 20 Left 980187178 4:129476606-129476628 CCCCACAATGATCCTTTGTATTT No data
Right 980187183 4:129476649-129476671 AAATTTAGGCAGCATATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980187183 Original CRISPR AAATTTAGGCAGCATATCTC TGG Intergenic