ID: 980188262

View in Genome Browser
Species Human (GRCh38)
Location 4:129490350-129490372
Sequence GCTTACAAGTGAAGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980188262_980188266 22 Left 980188262 4:129490350-129490372 CCTGCTGAGCTTCACTTGTAAGC No data
Right 980188266 4:129490395-129490417 GAGCACAGTGAGGGAGTTCTTGG No data
980188262_980188264 12 Left 980188262 4:129490350-129490372 CCTGCTGAGCTTCACTTGTAAGC No data
Right 980188264 4:129490385-129490407 CAACAGAGTAGAGCACAGTGAGG No data
980188262_980188267 28 Left 980188262 4:129490350-129490372 CCTGCTGAGCTTCACTTGTAAGC No data
Right 980188267 4:129490401-129490423 AGTGAGGGAGTTCTTGGAAAAGG No data
980188262_980188265 13 Left 980188262 4:129490350-129490372 CCTGCTGAGCTTCACTTGTAAGC No data
Right 980188265 4:129490386-129490408 AACAGAGTAGAGCACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980188262 Original CRISPR GCTTACAAGTGAAGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr