ID: 980188922

View in Genome Browser
Species Human (GRCh38)
Location 4:129497636-129497658
Sequence AGAGAAGGCCTGTTGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980188922_980188926 25 Left 980188922 4:129497636-129497658 CCTCAAGGCAACAGGCCTTCTCT No data
Right 980188926 4:129497684-129497706 CTGAGATCTTAAACTGGTTGAGG No data
980188922_980188925 19 Left 980188922 4:129497636-129497658 CCTCAAGGCAACAGGCCTTCTCT No data
Right 980188925 4:129497678-129497700 AACTTACTGAGATCTTAAACTGG No data
980188922_980188927 26 Left 980188922 4:129497636-129497658 CCTCAAGGCAACAGGCCTTCTCT No data
Right 980188927 4:129497685-129497707 TGAGATCTTAAACTGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980188922 Original CRISPR AGAGAAGGCCTGTTGCCTTG AGG (reversed) Intergenic
No off target data available for this crispr