ID: 980188923

View in Genome Browser
Species Human (GRCh38)
Location 4:129497651-129497673
Sequence GAATCTGTTGGTTAAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980188923_980188927 11 Left 980188923 4:129497651-129497673 CCTTCTCTTTAACCAACAGATTC No data
Right 980188927 4:129497685-129497707 TGAGATCTTAAACTGGTTGAGGG No data
980188923_980188926 10 Left 980188923 4:129497651-129497673 CCTTCTCTTTAACCAACAGATTC No data
Right 980188926 4:129497684-129497706 CTGAGATCTTAAACTGGTTGAGG No data
980188923_980188925 4 Left 980188923 4:129497651-129497673 CCTTCTCTTTAACCAACAGATTC No data
Right 980188925 4:129497678-129497700 AACTTACTGAGATCTTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980188923 Original CRISPR GAATCTGTTGGTTAAAGAGA AGG (reversed) Intergenic
No off target data available for this crispr