ID: 980188924

View in Genome Browser
Species Human (GRCh38)
Location 4:129497663-129497685
Sequence AGTAAGTTTGTAGAATCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980188924_980188926 -2 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188926 4:129497684-129497706 CTGAGATCTTAAACTGGTTGAGG No data
980188924_980188927 -1 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188927 4:129497685-129497707 TGAGATCTTAAACTGGTTGAGGG No data
980188924_980188928 19 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188928 4:129497705-129497727 GGGACTGCCATTGTCAATTTTGG No data
980188924_980188925 -8 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188925 4:129497678-129497700 AACTTACTGAGATCTTAAACTGG No data
980188924_980188929 22 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188929 4:129497708-129497730 ACTGCCATTGTCAATTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980188924 Original CRISPR AGTAAGTTTGTAGAATCTGT TGG (reversed) Intergenic
No off target data available for this crispr