ID: 980188925

View in Genome Browser
Species Human (GRCh38)
Location 4:129497678-129497700
Sequence AACTTACTGAGATCTTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980188923_980188925 4 Left 980188923 4:129497651-129497673 CCTTCTCTTTAACCAACAGATTC No data
Right 980188925 4:129497678-129497700 AACTTACTGAGATCTTAAACTGG No data
980188922_980188925 19 Left 980188922 4:129497636-129497658 CCTCAAGGCAACAGGCCTTCTCT No data
Right 980188925 4:129497678-129497700 AACTTACTGAGATCTTAAACTGG No data
980188924_980188925 -8 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188925 4:129497678-129497700 AACTTACTGAGATCTTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980188925 Original CRISPR AACTTACTGAGATCTTAAAC TGG Intergenic
No off target data available for this crispr