ID: 980188926

View in Genome Browser
Species Human (GRCh38)
Location 4:129497684-129497706
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980188922_980188926 25 Left 980188922 4:129497636-129497658 CCTCAAGGCAACAGGCCTTCTCT No data
Right 980188926 4:129497684-129497706 CTGAGATCTTAAACTGGTTGAGG No data
980188923_980188926 10 Left 980188923 4:129497651-129497673 CCTTCTCTTTAACCAACAGATTC No data
Right 980188926 4:129497684-129497706 CTGAGATCTTAAACTGGTTGAGG No data
980188924_980188926 -2 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188926 4:129497684-129497706 CTGAGATCTTAAACTGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr