ID: 980188929

View in Genome Browser
Species Human (GRCh38)
Location 4:129497708-129497730
Sequence ACTGCCATTGTCAATTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980188924_980188929 22 Left 980188924 4:129497663-129497685 CCAACAGATTCTACAAACTTACT No data
Right 980188929 4:129497708-129497730 ACTGCCATTGTCAATTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980188929 Original CRISPR ACTGCCATTGTCAATTTTGG TGG Intergenic
No off target data available for this crispr